ORFeome > hhatl ORF1 – XORFeome v1.0

hhatl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hhatl
Gene ID: 5744211
Gene Page ID: 5744179
ORF Xenbase ID: 17278893

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043836
Original XGC clone length: 1512

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ824144
dbEST ID: 79641846
Trimmed Sequence: ATGGGAATCAAAACGGCATTGCCGCATTACGAGCTGGGCTTCTATGCCCTAGTGGTGACTTGTGCCTTGGTCTACTCCTTGAATGGAATCATTGAAGCCTCCCGAGATGGCATGGATCGAAAGTCATTCCGGGAGAACATAAAGGAGGGCTGGCATTACTTCGGAAGGAAAATGGACGTTGCTGACTTTGAATGGGCCATGTGGTTCAACACATTCAGGAACTACATTATCTTCGCCCTTACAGGACACGTCATCTTTGCCAAGTTTTTTTCATTGATGGTTCCACAGTACAGATCATACGTTTACATGCTGTACGGGATCCTGACTGTGCTGGCAATCATGGGAAGCAACTACCTGATGCTCATCTTGTCCCACTGTTTCCTCCTCTATACCATTTCGCTGATTAAAAGCAAGTGGCTGTGCTTCATCGCTGGCCTCTGTAGCCTGGCCACCTTCAAAATGGAACCGTTCAGCACTTGGCAAAGTGGCTTTGTCACAGGGACGTTTAGCCTCCAAGACATTCTTTTCTACGGAGGCAGTGGATTTACCATACTGCGCTGTATGAGCTTCGCTTTTGGAGACGTGCGAGAGAAAACAAGGGTTCTACTCCCCCATAGATCTTCTCAAATACNATTTTTACCTCCCTTTCCTTTTCTCNNGCCGATNATGACTTTCGATCAGTACCACATGCAGGTGAACACGAGGATCTTAAATCCGGAAGAAAAATGAAAGTGGGAAAATCCTGAATCCTGGTCTGACCCAAAATTGGGGATCCCTTTTTGGTGAAAGGGTTTTTCCCTTTTTCCTTACTTCTTTACAATCCCCCCACAACCCAAAATTGTTCATAC
Full Trace Sequence: AATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAATCAAAACGGCATTGCCGCATTACGAGCTGGGCTTCTATGCCCTAGTGGTGACTTGTGCCTTGGTCTACTCCTTGAATGGAATCATTGAAGCCTCCCGAGATGGCATGGATCGAAAGTCATTCCGGGAGAACATAAAGGAGGGCTGGCATTACTTCGGAAGGAAAATGGACGTTGCTGACTTTGAATGGGCCATGTGGTTCAACACATTCAGGAACTACATTATCTTCGCCCTTACAGGACACGTCATCTTTGCCAAGTTTTTTTCATTGATGGTTCCACAGTACAGATCATACGTTTACATGCTGTACGGGATCCTGACTGTGCTGGCAATCATGGGAAGCAACTACCTGATGCTCATCTTGTCCCACTGTTTCCTCCTCTATACCATTTCGCTGATTAAAAGCAAGTGGCTGTGCTTCATCGCTGGCCTCTGTAGCCTGGCCACCTTCAAAATGGAACCGTTCAGCACTTGGCAAAGTGGCTTTGTCACAGGGACGTTTAGCCTCCAAGACATTCTTTTCTACGGAGGCAGTGGATTTACCATACTGCGCTGTATGAGCTTCGCTTTTGGAGACGTGCGAGAGAAAACAAGGGTTCTACTCCCCCATAGATCTTCTCAAATACNATTTTTACCTCCCTTTCCTTTTCTCNNGCCGATNATGACTTTCGATCAGTACCACATGCAGGTGAACACGAGGATCTTAAATCCGGAAGAAAAATGAAAGTGGGAAAATCCTGAATCCTGGTCTGACCCAAAATTGGGGATCCCTTTTTGGTGAAAGGGTTTTTCCCTTTTTCCTTACTTCTTTACAATCCCCCCACAACCCAAAATTGTTCATAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAATCAAAACGGCATTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829451
dbEST ID: 79647153
Trimmed Sequence: GGCGACTTTCTGCTTTTCAAGCCTCTCTTGCTCGATGGCTATTAGCCGCTCTCTCTCCTTTATCAGCTGCACCCCACAGTAAGTGACCAGCCAGATGGACAGGGTGCTTTCAGGGAAACCTGTGATTAGAAGCCTCTTGGCTACCAGCAGAGCAAAGTCCAGGCTGTTAAGGGCTAATATGTTATATAAAATGATTGCCCAGAAGTTGGCTGCACCGAAAAACCCTCTGATCCTCCTTGACATGGACTCCGGTAGCCTGGCCTCTATTCTTGCAAAGGGTCCGAGCTGGAAGAATTTCTGCACCCACAGTTCAAAGTTAAGGCCGAAGCAGTTGCAGACGGACCAGATATAAACAATTTCACACGGGCCGAGCCATAAAGTGGTGACGAGGAACGTAGCCACGGTGGCCACCAATTCCCTCCTAATATTATCGTGGCCTTCCCCGATGTAGTCATACACATATTTGCACAGCCAGTCATTTATCCCTCGGTCGAAGTGCGTTTCGGCGAAGACATAAAGCATGGTGATACACTTGGGTGGCTGTGGGGGATCAAGGTGGTCCAGCCTGGAGATGGTGTTGATAACGCCGAACATCACAGCGGCTTTTACCCAATCATACACCAAGGTTAGAGTAGGCCAAGCCCCGCCATGACCAATCAGAAAGGCGATTGACAAACTTTTAGGTTCTGAAGGGGATGGGTCAAGAAAGTAAAAAGAAAATGGGAAAGAACACGTTCTAACCCAAAAGGAAACCCCCCA
Full Trace Sequence: GGGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCGACTTTCTGCTTTTCAAGCCTCTCTTGCTCGATGGCTATTAGCCGCTCTCTCTCCTTTATCAGCTGCACCCCACAGTAAGTGACCAGCCAGATGGACAGGGTGCTTTCAGGGAAACCTGTGATTAGAAGCCTCTTGGCTACCAGCAGAGCAAAGTCCAGGCTGTTAAGGGCTAATATGTTATATAAAATGATTGCCCAGAAGTTGGCTGCACCGAAAAACCCTCTGATCCTCCTTGACATGGACTCCGGTAGCCTGGCCTCTATTCTTGCAAAGGGTCCGAGCTGGAAGAATTTCTGCACCCACAGTTCAAAGTTAAGGCCGAAGCAGTTGCAGACGGACCAGATATAAACAATTTCACACGGGCCGAGCCATAAAGTGGTGACGAGGAACGTAGCCACGGTGGCCACCAATTCCCTCCTAATATTATCGTGGCCTTCCCCGATGTAGTCATACACATATTTGCACAGCCAGTCATTTATCCCTCGGTCGAAGTGCGTTTCGGCGAAGACATAAAGCATGGTGATACACTTGGGTGGCTGTGGGGGATCAAGGTGGTCCAGCCTGGAGATGGTGTTGATAACGCCGAACATCACAGCGGCTTTTACCCAATCATACACCAAGGTTAGAGTAGGCCAAGCCCCGCCATGACCAATCAGAAAGGCGATTGACAAACTTTTAGGTTCTGAAGGGGATGGGTCAAGAAAGTAAAAAGAAAATGGGAAAGAACACGTTCTAACCCAAAAGGAAACCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCGACTTTCTGCTTTTCAA