ORFeome > hhip ORF1 – XORFeome v1.0

hhip ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hhip
Gene ID: 487503
Gene Page ID: 487498
ORF Xenbase ID: 17278899

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046952
Original XGC clone length: 2031

Human orthology & disease relationships

NCBI Entrez ID: 64399
Ensembl gene IDs: ENSG00000164161
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112500,120200,142945,147250,605462,607080,607778

Library Location

Plate ID: GDExl11017
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ824411
dbEST ID: 79642113
Trimmed Sequence: ATGAACAAGTTCCTGTTGGTGCAGTGGATGCTACTTTGCGCGATAGCTCTGCTTATTATGCAAAGTGACGCTAAGTTTGGGGAGAAGAGTGAGACTGGCGCAAGGAGAAGAAGGTGCCTCAATGGCAGCTCCCCGAGGCGTGTAAAAAAGCGACATAGAAAGTTACAGACTTTGGATCTGGGGGGAGCTGGAGAGGGGTGCAGGGGTCTTTATCCCCGACTCTCGTGTTGCCCCAAAACTGACATCCCTGGAATGCCAATGGACAGTAAGATCTTGTCTGTCGCCAACAACACAGAATGTGCAAAGCTTGTGGAAGAAATCCGGTGTGCCCACTGCTCGCCGCATGCTCAGAATCTTTTCCATGCAAGTGAGAGATCAGAAACATCAGAAAGGCAACTCTTCCTTCCTGTCCTGTGCAAGGACTATTGCAAAGAATTCTACTACACATGCCGAGGCCAGATACCAGGCTTACTTCAAACCTCAGCAGATGAATTTTGCTTTTACCACGGCATGAGAGACAGTGGATTGTGCTTCCCAGACTTTCCAAGGAAGCAGATGCGCGGGCCAGCGTCAAACTACTTGGATCAGATGGAAGATTATGACAAAGTGGAAGAGATCAGCAGGAAACATAAGCACAATTGCTACTGTATTCAGGAGGGTGGTGAGAGGCTTAAGACAACCACGTGGGTGCATGCATAATGGGAAATGGGGTCCCAACCACCATTCCTACTGGGGGAAGGAAGGCTACCTAAAGATTT
Full Trace Sequence: AATCGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACAAGTTCCTGTTGGTGCAGTGGATGCTACTTTGCGCGATAGCTCTGCTTATTATGCAAAGTGACGCTAAGTTTGGGGAGAAGAGTGAGACTGGCGCAAGGAGAAGAAGGTGCCTCAATGGCAGCTCCCCGAGGCGTGTAAAAAAGCGACATAGAAAGTTACAGACTTTGGATCTGGGGGGAGCTGGAGAGGGGTGCAGGGGTCTTTATCCCCGACTCTCGTGTTGCCCCAAAACTGACATCCCTGGAATGCCAATGGACAGTAAGATCTTGTCTGTCGCCAACAACACAGAATGTGCAAAGCTTGTGGAAGAAATCCGGTGTGCCCACTGCTCGCCGCATGCTCAGAATCTTTTCCATGCAAGTGAGAGATCAGAAACATCAGAAAGGCAACTCTTCCTTCCTGTCCTGTGCAAGGACTATTGCAAAGAATTCTACTACACATGCCGAGGCCAGATACCAGGCTTACTTCAAACCTCAGCAGATGAATTTTGCTTTTACCACGGCATGAGAGACAGTGGATTGTGCTTCCCAGACTTTCCAAGGAAGCAGATGCGCGGGCCAGCGTCAAACTACTTGGATCAGATGGAAGATTATGACAAAGTGGAAGAGATCAGCAGGAAACATAAGCACAATTGCTACTGTATTCAGGAGGGTGGTGAGAGGCTTAAGACAACCACGTGGGTGCATGCATAATGGGAAATGGGGTCCCAACCACCATTCCTACTGGGGGAAGGAAGGCTACCTAAAGATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAAGTTCCTGTTGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829767
dbEST ID: 79647469
Trimmed Sequence: GCCTGCCCTGGCCACTCTCCGGACGTTTCTATCCATTTGCTCACACTGTGGGCCCAAGTATCCTTTTTTACATAAACACTTGTTTGGTCTCACGCAGACGCCTCCATGCCGACACTCTGGTTCACATTTTGCAATTCTGCAGAACTCTCCTTCCCATCCTTGAGCGCAGCAGCATTTCCCTGTTGGAGTGCAGTGTCCATTTCGGCAGTGACGGGAGCACTCAGAGGCAAGTGGCTGTGCAGGCATTAGCGGACGTTTGCATTCTTCTGGAACTGTTGGTCTTTTTGGATCAATAATTTTGTAGATTTTCCCACTGTGTGACTGGGTCATGCTTTTACTGCTTGACAAAATGTAAACTTCACCTAATTCGTCTTCTCCAAACCCCAGTATGTGTCCTGTAAAAGGGGCTCTGCAGGAAGATCCACTGCCGAGACAGAGGGGTTTCTCCTGCCAATGCTTTGTAACTGGGTTCTGATGAAGTGTTATAAAATTCCCATAGCGATCTCCAAACACGTAGCTTCCATACAGCCTCTCTGACTGACAACCTCTATATACAAATCCCCCAACCATGTGTCCACTGCTCAATGGTTTAAATTCCAAAAGGGGAGGATCATTTTCATAATCTTTCCCTTTGACAATCTGTAAAATTCTTGCAGCTGATCTGTTTTTAGCGCTTGAAATCTGAAACAAAGAATAATTCAGGATTCATTGTTCTTTTGGAGTTGATTGATCCAACAAGTACATTCCTGCCCC
Full Trace Sequence: CAAGCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCTGCCCTGGCCACTCTCCGGACGTTTCTATCCATTTGCTCACACTGTGGGCCCAAGTATCCTTTTTTACATAAACACTTGTTTGGTCTCACGCAGACGCCTCCATGCCGACACTCTGGTTCACATTTTGCAATTCTGCAGAACTCTCCTTCCCATCCTTGAGCGCAGCAGCATTTCCCTGTTGGAGTGCAGTGTCCATTTCGGCAGTGACGGGAGCACTCAGAGGCAAGTGGCTGTGCAGGCATTAGCGGACGTTTGCATTCTTCTGGAACTGTTGGTCTTTTTGGATCAATAATTTTGTAGATTTTCCCACTGTGTGACTGGGTCATGCTTTTACTGCTTGACAAAATGTAAACTTCACCTAATTCGTCTTCTCCAAACCCCAGTATGTGTCCTGTAAAAGGGGCTCTGCAGGAAGATCCACTGCCGAGACAGAGGGGTTTCTCCTGCCAATGCTTTGTAACTGGGTTCTGATGAAGTGTTATAAAATTCCCATAGCGATCTCCAAACACGTAGCTTCCATACAGCCTCTCTGACTGACAACCTCTATATACAAATCCCCCAACCATGTGTCCACTGCTCAATGGTTTAAATTCCAAAAGGGGAGGATCATTTTCATAATCTTTCCCTTTGACAATCTGTAAAATTCTTGCAGCTGATCTGTTTTTAGCGCTTGAAATCTGAAACAAAGAATAATTCAGGATTCATTGTTCTTTTGGAGTTGATTGATCCAACAAGTACATTCCTGCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCTGCCCTGGCCACTCT