ORFeome > HIF-1a ORF1 – XORFeome v1.0

HIF-1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252260
Gene Page ID:
ORF Xenbase ID: 17254239

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126005
Original XGC clone length: 2403

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ837281
dbEST ID: 79654983
Trimmed Sequence: ATGGAGGGATCAGTTGTAGTGAGCGAGAAGAAAAGGATCAGCTCTGAGCGGCGTAAAGAAAAATCACGTGATGCTGCCAGGTGTCGACTCGGACAGGCCCAGTAGTGCAGAGCGGAGAACAATGCTCTTGCTGTCAACAGATATGTCAAGTCAGTTGATTAGACGGTCTTTGGATGGAACTGGTCTTCCTCAGCTGACTGGGTATGACTGCGAGGTGAATGCCCCTGTTCATGGCAACAGAAACTTGCTCCAAGGTGAAGATCTACTACGAGCTCTAGATCAAGCTAACTT
Full Trace Sequence: GGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGATCAGTTGTAGTGAGCGAGAAGAAAAGGATCAGCTCTGAGCGGCGTAAAGAAAAATCACGTGATGCTGCCAGGTGTCGACTCGGACAGGCCCAGTAGTGCAGAGCGGAGAACAATGCTCTTGCTGTCAACAGATATGTCAAGTCAGTTGATTAGACGGTCTTTGGATGGAACTGGTCTTCCTCAGCTGACTGGGTATGACTGCGAGGTGAATGCCCCTGTTCATGGCAACAGAAACTTGCTCCAAGGTGAAGATCTACTACGAGCTCTAGATCAAGCTAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAACAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAAAAAAAACTCATAATCTCTTATGTTACAATCGNCCTGCGGACTGGCTGTGAAAAAGNGGACCTGACTTTTTTTTTCCCCCGGCCTTTCGGTTTGTGTCGTTTTTGTTGTCGCTTTCGCGGTGGCGTGNNGCCGGGCCTCTCTCCCCTGNTNNTGTGGNGCGTTCCCTTGGCGCGTGCGCGTGGTGCCGCGCTCCGGGCGCCNGTGGCGTGTTCCNCGTGGNGGGGTGGGTCTCGGTGGGGTCGGNCTNGNGTGCCGCGGGGGGGCTGGGCCGGGGGGCGCCCNNTTGGTGCTCGTCNGGCGGTGTNCTCTGGTGGCGNNGTCCTGGTCGTTTCGCCNTTNTNGTTTTCTCTNN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGATCAGTTGTAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837280
dbEST ID: 79654982
Trimmed Sequence: GTTAGCTTGATCTAGAGCTCGTAGTAGATCTTCACCTTGGAGCAAGTTTCTGTTGCCATGAACAGGGGCATTCACCTCGCAGTCATAGCCAGTCAGCTGAGGAAGACCAGTTCCATCCAAAGACTGTCTAATCAACTGACTTGACATATCTGTTGACAGCAAGAGCATTGTTCTTTGCTCTGCACTACTGGGCCTGTCCGAGTCGACACCTGGCAGCATCACGTGATTTTTCTTTACGCCGCTCAGAGCTGATCCTTTTCTTCTCGCTCACTACAACTGATCCCTCCATGG
Full Trace Sequence: GGGGAACTGCTTATGACCATGTAATACGACTCACTATAGGGGGATGATCAGCTGGATGGCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTAGCTTGATCTAGAGCTCGTAGTAGATCTTCACCTTGGAGCAAGTTTCTGTTGCCATGAACAGGGGCATTCACCTCGCAGTCATAGCCAGTCAGCTGAGGAAGACCAGTTCCATCCAAAGACTGTCTAATCAACTGACTTGACATATCTGTTGACAGCAAGAGCATTGTTCTTTGCTCTGCACTACTGGGCCTGTCCGAGTCGACACCTGGCAGCATCACGTGATTTTTCTTTACGCCGCTCAGAGCTGATCCTTTTCTTCTCGCTCACTACAACTGATCCCTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCTATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGTGGCCCGAGCTTAAAACAAAAAATCATTTTTCNACGTGTGGCCTGGGGTNNNNNNNNGGNNNNNNGGGGAAAAAGGNGNNNNCNCNNCGGGNGCCGNGGGGGNGGNNNNNNNGGGGNGNGGGGGGGNGNGGGGNNNGGGNNGNNGNNGNNGNNNNGGGNNNNNNNGGGGGGGGGNNGGGNNGGGGGGGGGGGGGGGGNNGGNNGGGGGGNNNGNGNGGGGNNGNGNNNNGGGNGNGNNNNGGGNNGNGGGGGGGNGNNNNNNGGNNNGNNNNNGGGGNNGNGNNGGGNNNGGGGGNAAAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTAGCTTGATCTAGAGCTCGT