ORFeome > hist1h4d ORF1 – XORFeome v1.0

hist1h4d ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hist1h4d
Gene ID: 6466049
Gene Page ID: 5897727
ORF Xenbase ID: 17279037

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130133
Original XGC clone length: 312

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ838566
dbEST ID: 79656268
Trimmed Sequence: ATGTCTGGAAGAGACAAGGGCGGAAAGGGTCTGGGCAATAGAGGCGCTAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGCATCACCAAGCCCGCCCTCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATCTACGAGGAGACTCGCGGCGTGTTGAAGGTGTTCCTGGAGAACGTTATCCGGGACGCGGTCACCTACACCGAGCACGCCAAGAGGAAGACCGTCACCGCTATGGATGTGGTGTATGTTCTGAAGCGCCAGGGACGCACTCTGTACGGATTCGGGGGTTT
Full Trace Sequence: TACGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAAGAGACAAGGGCGGAAAGGGTCTGGGCAATAGAGGCGCTAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGCATCACCAAGCCCGCCCTCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATCTACGAGGAGACTCGCGGCGTGTTGAAGGTGTTCCTGGAGAACGTTATCCGGGACGCGGTCACCTACACCGAGCACGCCAAGAGGAAGACCGTCACCGCTATGGATGTGGTGTATGTTCTGAAGCGCCAGGGACGCACTCTGTACGGATTCGGGGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAAAAAAAAAAAAAATCTCTAAATAACAAAAAATNGGGGNTGNGTTGAAAAAAAAACCTNGGGTTTCGGTTNTGGCGGTTTTGCTGGTTTTTCCTTGGGGGGGTNGTCNCCCCTTCGTTCCCGTGCCCGCCCTGTGTGGGGGGGGGTNTGTGTGTGTTGTGGCGTGCGCGGTTTGCTGGCTCNTGTGTGTGNCGCGGGCGGGTGGCGGTGGTGTTTGTTTTGTTGTGGGTGGGTGTGTGGGGTTTGTGTGTTCTCTTGCTGTGTGTCGGGTTGGGGTTGCTGGGGGCGCGCTGGGTGGGTTGTCGCGTGGGTGGGGGTGGGTGTTTGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAAGAGACAAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838565
dbEST ID: 79656267
Trimmed Sequence: ACCCCCGAATCCGTACAGAGTGCGTCCCTGGCGCTTCAGAACATACACCACATCCATAGCGGTGACGGTCTTCCTCTTGGCGTGCTCGGTGTAGGTGACCGCGTCCCGGATAACGTTCTCCAGGAACACCTTCAACACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTGACTCCCCCTCTGCGTGCCAGGCGGCGGAGGGCGGGCTTGGTGATGCCCTGGATGTTATCCCGCAGCACCTTCCTGTGGCGCTTANCGCCTCTATTGCCCAGACCCTTTCCGCCCTTGTCTCTTCCAGACATGG
Full Trace Sequence: AAACAGGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCCCCGAATCCGTACAGAGTGCGTCCCTGGCGCTTCAGAACATACACCACATCCATAGCGGTGACGGTCTTCCTCTTGGCGTGCTCGGTGTAGGTGACCGCGTCCCGGATAACGTTCTCCAGGAACACCTTCAACACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTGACTCCCCCTCTGCGTGCCAGGCGGCGGAGGGCGGGCTTGGTGATGCCCTGGATGTTATCCCGCAGCACCTTCCTGTGGCGCTTANCGCCTCTATTGCCCAGACCCTTTCCGCCCTTGTCTCTTCCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGACCTTAATAGTAAAAAAAAATATTACAACATCAAAGACATGAGAGGNNCNNGGAACNCAAAAAACAAAAAANANAAAAAAAAAAAAAAAAAAGAGNNGGGNNGNGTTAAGAANNNNNGGNNNGGAGGAGGNNNNNNNNNANAAAGNNNNNNNNNGCNTNTGGNGNNNGAGAGGAGGGAAGGAAAAAGAGAGNNNNNANNNNGNGGNGNNNNAGGNNNTNNNGNNNNNNGNNNNGGGGNNGNGGGGGGGNNNNNNNGTNNNNGGNNNNTNNNNNNGNNNNNNNNGGNGGGNGNNNNNGGGGGGNNNNGGGGGAAGGGGGNNGAGGANNNAAGNGNNGGGNGGGGGGGNGNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCCCCGAATCCGTACA