ORFeome > hla-drb1 ORF1 – XORFeome v1.0

hla-drb1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hla-drb1
Gene ID: 945976
Gene Page ID: 945970
ORF Xenbase ID: 17279079

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099256
Original XGC clone length: 783

Human orthology & disease relationships

NCBI Entrez ID: 3123
Ensembl gene IDs: ENSG00000196126,ENSG00000206240,ENSG00000206306,ENSG00000228080,ENSG00000229074,ENSG00000236884
Directly associated (OMIM) disease MIM numbers: 126200,180300,181000
Indirectly associated (Lage, et al.) disease MIM numbers: 135300,181000,608971

Library Location

Plate ID: GDExl11006
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ840087
dbEST ID: 79657789
Trimmed Sequence: ATGTACAACATACCAGTGCCTGTATTGTGTGTGCTACTGACCCTGGGACTATGTCTCTGCTCCTCCCCCCCAGAGGATTTCGTGTATCAGTACAAAGCTCAGTGTTACTTCAGGAACGGCACCGACAATGTCAGGTTTCTGTGGCGCCACTACTATAACCTGGAAGAAACCGATTACTTTGACAGTGATGTGGGTTTGTTTATCGCTAAAACCGAGCTGGGGAAACCGAGTGCGGATTATTGGAACAGCCAGAAGGATTTCCTAGAGCAGACACGGGCTGCGGTGGATACAGTCTGCGGACCCAACTATCAGCTAAATAAACCCTTCACTATAGACAGGAAATCTCAACCCAATGTGAAGATTGTAAACACAAAGACATTGGATTTGGAACATGAAAACCTGATAACCTGCTTTGTGGATGGGTTTTTTCCTCCTATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAAGGAGAACAGGTTACATCCTCAGAGTTATTACAGAATGCAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGTGACACTTTCACCTGCCGGGTGGAGCACAGCAGCCTGCAACAACCTGTATCTGTAAACTGGGAGCCAGATGTATCTGAATCTGCTCGCAATAAGATGTTGACTGGTATTGTTTGGGTTTGTGCTTGGATCCATCTTCATCATAATTTGCCCTCTTAGTCCACCTTCCGGAATAAAAAGAACTATGACTCCCTTTTTCACCTTTTACGAAATGAAA
Full Trace Sequence: CCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACAACATACCAGTGCCTGTATTGTGTGTGCTACTGACCCTGGGACTATGTCTCTGCTCCTCCCCCCCAGAGGATTTCGTGTATCAGTACAAAGCTCAGTGTTACTTCAGGAACGGCACCGACAATGTCAGGTTTCTGTGGCGCCACTACTATAACCTGGAAGAAACCGATTACTTTGACAGTGATGTGGGTTTGTTTATCGCTAAAACCGAGCTGGGGAAACCGAGTGCGGATTATTGGAACAGCCAGAAGGATTTCCTAGAGCAGACACGGGCTGCGGTGGATACAGTCTGCGGACCCAACTATCAGCTAAATAAACCCTTCACTATAGACAGGAAATCTCAACCCAATGTGAAGATTGTAAACACAAAGACATTGGATTTGGAACATGAAAACCTGATAACCTGCTTTGTGGATGGGTTTTTTCCTCCTATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAAGGAGAACAGGTTACATCCTCAGAGTTATTACAGAATGCAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGTGACACTTTCACCTGCCGGGTGGAGCACAGCAGCCTGCAACAACCTGTATCTGTAAACTGGGAGCCAGATGTATCTGAATCTGCTCGCAATAAGATGTTGACTGGTATTGTTTGGGTTTGTGCTTGGATCCATCTTCATCATAATTTGCCCTCTTAGTCCACCTTCCGGAATAAAAAGAACTATGACTCCCTTTTTCACCTTTTACGAAATGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACAACATACCAGTGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ840086
dbEST ID: 79657788
Trimmed Sequence: CATTAGATTTTCATTCTGTACAGCTGAAAAGTGAGTCATAGTCTTCTTACTCCGGAGGTAGACTACGAGGCCAACTATGATGAAGATGGATCCAAGCACAAACCCAACAATACCAGTCAACATCTTATTGCGAGCAGATTCAGATACATCTGGCTCCCAGTTTACAGATACAGGTTGTTGCAGGCTGCTGTGCTCCACCCGGCAGGTGAAAGTGTCACCATGTTTAATGGTTGTCTCCAGCATCACATGGATTTCAAATGTCCAGTCTGCATTCTGTAATAACTCTGAGGATGTAACCTGTTCTCCTTCTTCAATCCCATTCTTCAGCCAAGTCACCTTTATCATAGGAGGAAAAAACCCATCCACAAAGCAGGTTATCAGGTTTTCATGTTCCAAATCCAATGTCTTTGTGTTTACAATCTTCACATTGGGTTGAGATTTCCTGTCTATAGTGAAGGGTTTATTTAGCTGATAGTTGGGTCCGCAGACTGTATCCACCGCAGCCCGTGTCTGCTCTAGGAAATCCTTCTGGCTGTTCCAATAATCCGCACTCGGTTTCCCCAGCTCGGTTTTAGCGATTAACAAACCCACATCACTGTCAAAGTAATCGGGTTCTTCCAGGTTAAGTAATGGCGCCACAGAAACCTGACATTTGTCGGTGCCCTTCCCCGAAATAACCCCTGAGCTTTTTACTGATACACCAAAATCCTCTTGGGG
Full Trace Sequence: CGGAACCATGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTAGATTTTCATTCTGTACAGCTGAAAAGTGAGTCATAGTCTTCTTACTCCGGAGGTAGACTACGAGGCCAACTATGATGAAGATGGATCCAAGCACAAACCCAACAATACCAGTCAACATCTTATTGCGAGCAGATTCAGATACATCTGGCTCCCAGTTTACAGATACAGGTTGTTGCAGGCTGCTGTGCTCCACCCGGCAGGTGAAAGTGTCACCATGTTTAATGGTTGTCTCCAGCATCACATGGATTTCAAATGTCCAGTCTGCATTCTGTAATAACTCTGAGGATGTAACCTGTTCTCCTTCTTCAATCCCATTCTTCAGCCAAGTCACCTTTATCATAGGAGGAAAAAACCCATCCACAAAGCAGGTTATCAGGTTTTCATGTTCCAAATCCAATGTCTTTGTGTTTACAATCTTCACATTGGGTTGAGATTTCCTGTCTATAGTGAAGGGTTTATTTAGCTGATAGTTGGGTCCGCAGACTGTATCCACCGCAGCCCGTGTCTGCTCTAGGAAATCCTTCTGGCTGTTCCAATAATCCGCACTCGGTTTCCCCAGCTCGGTTTTAGCGATTAACAAACCCACATCACTGTCAAAGTAATCGGGTTCTTCCAGGTTAAGTAATGGCGCCACAGAAACCTGACATTTGTCGGTGCCCTTCCCCGAAATAACCCCTGAGCTTTTTACTGATACACCAAAATCCTCTTGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTAGATTTTCATTCTGTACAGC