ORFeome > hmg20b ORF1 – XORFeome v1.0

hmg20b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hmg20b
Gene ID: 5809135
Gene Page ID: 5809047
ORF Xenbase ID: 17279127

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123347
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ837589
dbEST ID: 79655291
Trimmed Sequence: ATGTCTCAACCAACTAAACATTTTCATGGGATTTTGCACCCTGTATCAAAAACACAAGGTGGGAATTTTCTCGTGGCTATAAAACAAGAAAAAGTAGAAGTCCAAACAGTTGGTGATAAGAGCACAGGGGGAGAGGAAGAGCCTGTAAAGAAACGGGGATGGCCAAAAGGAAAGAAGAGAAAAAAGATCCTTCCCAATGGCCCCAAAGCTCCAGTCACAGGTTATGTTCGATTTTTGAATGAGCGAAGAGAGCAGATTCGAGCACAGCATCCAGATCTTCCTTTCCCTGAGATTACAAAGATGCTTGGGGCAGAGTGGAGCACACTGCCAGCACATGAGAAGCAGAGATACTTAGATGAAGCTGAGAGGGATAAGCAGCAGTATATGAAAGAGCTTCGAGAATACCAGCAGTCGGAAGCATACAAGATGTGTGCAGAAAAGATCCAAGAGAAAAAAATTAAAAAAGAAGAAACCAGTGCGGCAGCTATCAGTACCTTGTTAAATGGACACATACAAAAAACTGGTGATCCCCAGACTGATGGGTTTTCCAGTTTTGATATGACTATATTTACAGAAGAGTTTCTGGATCAGAACAAAGTCCGTGAAGCAAAGCTAAGAGGACTGCGCAAGATAAAAATGGAGTTTAAAGAACAGAATGCAATCTTACAACGACACACACAAAACATGAATTGTGCCAAGAAGAGGCTAGAAAAAAGAAATTGCTCAAGGAGGAAAAGCAAAAGAAAGGGCTCCTCCAGCAAGCAAAATTCAAAACAAACCCCCCCAAAATCCTAGTGG
Full Trace Sequence: GAGGGCCTATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCAACCAACTAAACATTTTCATGGGATTTTGCACCCTGTATCAAAAACACAAGGTGGGAATTTTCTCGTGGCTATAAAACAAGAAAAAGTAGAAGTCCAAACAGTTGGTGATAAGAGCACAGGGGGAGAGGAAGAGCCTGTAAAGAAACGGGGATGGCCAAAAGGAAAGAAGAGAAAAAAGATCCTTCCCAATGGCCCCAAAGCTCCAGTCACAGGTTATGTTCGATTTTTGAATGAGCGAAGAGAGCAGATTCGAGCACAGCATCCAGATCTTCCTTTCCCTGAGATTACAAAGATGCTTGGGGCAGAGTGGAGCACACTGCCAGCACATGAGAAGCAGAGATACTTAGATGAAGCTGAGAGGGATAAGCAGCAGTATATGAAAGAGCTTCGAGAATACCAGCAGTCGGAAGCATACAAGATGTGTGCAGAAAAGATCCAAGAGAAAAAAATTAAAAAAGAAGAAACCAGTGCGGCAGCTATCAGTACCTTGTTAAATGGACACATACAAAAAACTGGTGATCCCCAGACTGATGGGTTTTCCAGTTTTGATATGACTATATTTACAGAAGAGTTTCTGGATCAGAACAAAGTCCGTGAAGCAAAGCTAAGAGGACTGCGCAAGATAAAAATGGAGTTTAAAGAACAGAATGCAATCTTACAACGACACACACAAAACATGAATTGTGCCAAGAAGAGGCTAGAAAAAAGAAATTGCTCAAGGAGGAAAAGCAAAAGAAAGGGCTCCTCCAGCAAGCAAAATTCAAAACAAACCCCCCCAAAATCCTAGTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCAACCAACTAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837588
dbEST ID: 79655290
Trimmed Sequence: CAGGTGATCACTGTTTATCCGGGACAAAACCTCTTTTATCTTGATAACCAGTTTTTCATGTTGAGTTGGGTTACCCTCTATCAGATTATGAAGTTTGGCCATGTACACATCAAGGTTTCCTAATGTTGGTGTCTCCCCTGTACCTGGAATTGGCAAGGAAGAAAAGCTAGACAATAGAATCTGGCGGATAGTTTGAATCTGCTGCTGGAGAGCCATTGTTTGCCTTTCCTCCTGAGCAAGTTCTTGTTCTAGCCTCTCCTTGGCACAATTCATGCTCTCTGTGTGTCGTTGTAAGATAGCATTCTGCTCCTCAAACTCCATATTCATCTTGCGCAGTCTTCTTAGCTCTGCTTCACGGACTTTGTTCTGATCCAGAAACTCTTCTGTAAATATAGTCATATCAAAACTGGAAAACCCATCACTCTGGGGATCACCAGTTTTTTGTATGTGTCCATTTAACAAGGTACTGATAGCTGCCGCACTGGTTTCTTCTTTTTTAATTTTTTTCTCTTGGATCTTTTCTGCACACATGGTGTAAGCTTCCGACCGCTGGGAGGCGCGAAGCTCTTTCATATACAGGTAAATATCCGTGTCAACTTCCACTAAGTATCTCTTCCTCTCCATTTGCCGGCAAGTGGGGGGGGCTGGGGCCCGAAGCCTCCTTTGTAATCCTTTGGAAAAAAGAAGAAACGGGGGAAGCGGGCCGCAAAGGCGCGGCGCGTCCCCTCTGCTCCAAAAAAAGAAAAGAAAAAACCGAGAGAACATAAAAATCCTTTGGGGG
Full Trace Sequence: GGGAAAATGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGTGATCACTGTTTATCCGGGACAAAACCTCTTTTATCTTGATAACCAGTTTTTCATGTTGAGTTGGGTTACCCTCTATCAGATTATGAAGTTTGGCCATGTACACATCAAGGTTTCCTAATGTTGGTGTCTCCCCTGTACCTGGAATTGGCAAGGAAGAAAAGCTAGACAATAGAATCTGGCGGATAGTTTGAATCTGCTGCTGGAGAGCCATTGTTTGCCTTTCCTCCTGAGCAAGTTCTTGTTCTAGCCTCTCCTTGGCACAATTCATGCTCTCTGTGTGTCGTTGTAAGATAGCATTCTGCTCCTCAAACTCCATATTCATCTTGCGCAGTCTTCTTAGCTCTGCTTCACGGACTTTGTTCTGATCCAGAAACTCTTCTGTAAATATAGTCATATCAAAACTGGAAAACCCATCACTCTGGGGATCACCAGTTTTTTGTATGTGTCCATTTAACAAGGTACTGATAGCTGCCGCACTGGTTTCTTCTTTTTTAATTTTTTTCTCTTGGATCTTTTCTGCACACATGGTGTAAGCTTCCGACCGCTGGGAGGCGCGAAGCTCTTTCATATACAGGTAAATATCCGTGTCAACTTCCACTAAGTATCTCTTCCTCTCCATTTGCCGGCAAGTGGGGGGGGCTGGGGCCCGAAGCCTCCTTTGTAATCCTTTGGAAAAAAGAAGAAACGGGGGAAGCGGGCCGCAAAGGCGCGGCGCGTCCCCTCTGCTCCAAAAAAAGAAAAGAAAAAACCGAGAGAACATAAAAATCCTTTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTGATCACTGTTTATCC