ORFeome > hmgb1 ORF1 – XORFeome v1.0

hmgb1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hmgb1
Gene ID: 1001213
Gene Page ID: 1001205
ORF Xenbase ID: 17279139

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054148
Original XGC clone length: 636

Human orthology & disease relationships

NCBI Entrez ID: 3146
Ensembl gene IDs: ENSG00000189403
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,109800,133239,136680,137357,151623,194070,194080,211980,230350,256370,259500,260500,260920,275355,300055,300279,300291,300301,300458,300496,300584,308300,312750,601675,607136,609048,609322

Library Location

Plate ID: GDExl11001
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ839221
dbEST ID: 79656923
Trimmed Sequence: ATGGGTAAAGGTGATCCTAAGAAGCCAAGAGGAAAAATGTCCTCATATGCTTACTTTGTGCAAACTTGCAGAGAAGAGCACAAGAAAAAGCACCCTGATGCCTCTGTAAATTTTGCAGAGTTTTCTAAGAAATGCTCAGAAAGGTGGAAGACTATGTCTGCTAAGGAAAAGTCAAAGTTTGAAGATATGGCAAAAGCTGACAAAGTTCGCTATGAGAGAGAAATGAAAACTTATATACCACCCAAAGGGGAAACAAAAAAGAAGTTTAAGGACCCTAATGCACCAAAGAGACCACCTTCAGCGTTCTTCTTATTCTGCTCTGAATTCCGTCCAAAAATCAAAGGGGAGCACCCTGGTTCGACTATTGGCGACATAGCAAAAAAACTGGGAGAAATGTGGAATAACACTGCTACAGATGACAAGCTTCCTTTCGAAAGGAAAGCTGCCAAGCTGAAGGAGAAATATGAAAAGGATGTTGCAGCATATAGGGCTAAGGGAAAGCCAGAACCTGCAAAAAAAGCTCCAGCTAAACCAGAAAAAGCCAAGAAGAAGGAGGAGGATGATGAGGATGACGACGAAGAGGATGAAGATGAAAAAAACGAAGAGGAGGAGGAAGAGGAAGATGATGATGAATTT
Full Trace Sequence: AGCTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAAAGGTGATCCTAAGAAGCCAAGAGGAAAAATGTCCTCATATGCTTACTTTGTGCAAACTTGCAGAGAAGAGCACAAGAAAAAGCACCCTGATGCCTCTGTAAATTTTGCAGAGTTTTCTAAGAAATGCTCAGAAAGGTGGAAGACTATGTCTGCTAAGGAAAAGTCAAAGTTTGAAGATATGGCAAAAGCTGACAAAGTTCGCTATGAGAGAGAAATGAAAACTTATATACCACCCAAAGGGGAAACAAAAAAGAAGTTTAAGGACCCTAATGCACCAAAGAGACCACCTTCAGCGTTCTTCTTATTCTGCTCTGAATTCCGTCCAAAAATCAAAGGGGAGCACCCTGGTTCGACTATTGGCGACATAGCAAAAAAACTGGGAGAAATGTGGAATAACACTGCTACAGATGACAAGCTTCCTTTCGAAAGGAAAGCTGCCAAGCTGAAGGAGAAATATGAAAAGGATGTTGCAGCATATAGGGCTAAGGGAAAGCCAGAACCTGCAAAAAAAGCTCCAGCTAAACCAGAAAAAGCCAAGAAGAAGGAGGAGGATGATGAGGATGACGACGAAGAGGATGAAGATGAAAAAAACGAAGAGGAGGAGGAAGAGGAAGATGATGATGAATTTGCCACTTTCTTGTACAAAGTTGGGATTATAAGAAAGCATTGCTAATCATTTTTGTTGCAACGAAACGGGTCACTAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAAAGGTGATCCTAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839220
dbEST ID: 79656922
Trimmed Sequence: TTCATCATCATCCTCCTCTTCCTCCTCCTCTTCGTCTTCTTCATCTTCATCCTCTTCGTCGTCATCCTCATCATCCTCCTCCTTCTTCTTGGCTTTTTCTGGTTTAGCTGGAGCTTTTTTTGCAGGTTCTGGCTTTCCCTTAGCCCTATATGCTGCAACATCCTTTTCATATTTCTCCTTCAGCTTGGCAGCTTTCCTTTCGAAAGGAAGCTTGTCATCTGTAGCAGTGTTATTCCACATTTCTCCCAGTTTTTTTGCTATGTCGCCAATAGTCGAACCAGGGTGCTCCCCTTTGATTTTTGGACGGAATTCAGAGCAGAATAAGAAGAACGCTGAAGGTGGTCTCTTTGGTGCATTAGGGTCCTTAAACTTCTTTTTTGTTTCCCCTTTGGGTGGTATATAAGTTTTCATTTCTCTCTCATAGCGAACTTTGTCAGCTTTTGCCATATCTTCAAACTTTGACTTTTCCTTAGCAGACATAGTCTTCCACCTTTCTGAGCATTTCTTAGAAAACTCTGCAAAATTTACAGAGGCATCAGGGTGCTTTTTCTTGTGGTCTTCTCTTGCAGTTTGCACAAAGTAAGCATATGAAGGACATTTTTTCCTCTTGGCCTTCTTAGGATCACCTTTTACCCATGGTGCCCAACTTTTTTTTGTAAAAAGTTGGGAAATATAAAAAAACCATTGGCTTCATCAATTT
Full Trace Sequence: GCCGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCATCATCCTCCTCTTCCTCCTCCTCTTCGTCTTCTTCATCTTCATCCTCTTCGTCGTCATCCTCATCATCCTCCTCCTTCTTCTTGGCTTTTTCTGGTTTAGCTGGAGCTTTTTTTGCAGGTTCTGGCTTTCCCTTAGCCCTATATGCTGCAACATCCTTTTCATATTTCTCCTTCAGCTTGGCAGCTTTCCTTTCGAAAGGAAGCTTGTCATCTGTAGCAGTGTTATTCCACATTTCTCCCAGTTTTTTTGCTATGTCGCCAATAGTCGAACCAGGGTGCTCCCCTTTGATTTTTGGACGGAATTCAGAGCAGAATAAGAAGAACGCTGAAGGTGGTCTCTTTGGTGCATTAGGGTCCTTAAACTTCTTTTTTGTTTCCCCTTTGGGTGGTATATAAGTTTTCATTTCTCTCTCATAGCGAACTTTGTCAGCTTTTGCCATATCTTCAAACTTTGACTTTTCCTTAGCAGACATAGTCTTCCACCTTTCTGAGCATTTCTTAGAAAACTCTGCAAAATTTACAGAGGCATCAGGGTGCTTTTTCTTGTGGTCTTCTCTTGCAGTTTGCACAAAGTAAGCATATGAAGGACATTTTTTCCTCTTGGCCTTCTTAGGATCACCTTTTACCCATGGTGCCCAACTTTTTTTTGTAAAAAGTTGGGAAATATAAAAAAACCATTGGCTTCATCAATTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCATCATCCTCCTCTTC