ORFeome > hmgb2 ORF1 – XORFeome v1.0

hmgb2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hmgb2
Gene ID: 1000251
Gene Page ID: 1000245
ORF Xenbase ID: 17279145

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041262
Original XGC clone length: 639

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ823718
dbEST ID: 79641420
Trimmed Sequence: ATGGGCAAGGGAGATCCTAACAAGCCTCGGGGGAAGATGTCCTCCTATGCCTACTTTGTGCAGACGTGCAGGGAAGAGCACAAGAAGAAACACCCCGACTCCTCCGTCAACTTCGCTGAGTTCTCCAAGAAATGCTCCGAGAGGTGGAAGACCATGTCTGCAAAAGAAAAGGGAAAGTTTGAGGACATGGCTAAAGGTGATAAAGTCCGGTATGAACGCGAGATGAAAACCTACATACCACCAAAAGGAGAGACAAAGGGAAAGAAAAAGAAGGATCCAAATGCACCAAAAAGGCCGCCATCTGCCTTTTTCCTCTTTTGTTCTGAGCAACGTCCCCAGATAAAGAGCGAGACTCCTGGTCTTTCCATTGGTGACACGGCTAAGAAACTAGGAGAGCGGTGGTCAGAACAGACTTCTAAGGACAAGTTACCATTTGAGCAAAAGGCAGCCAAACTAAAGGAAAAATATGAGAAGGATGTTGCCGCATACCGGGCTAAGGGCAAAAGTGATGTCGGCAAGAAAGTTCCAGGAAGGCCGACGGGTTCTAAAAAGAAGGCAGAACCAGAAGATGATGATGATGAAGACGAGGATGACGAAGATGATGAGGAGGATGAAGATGATGAGGATGGATGATGAATT
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCAAGGGAGATCCTAACAAGCCTCGGGGGAAGATGTCCTCCTATGCCTACTTTGTGCAGACGTGCAGGGAAGAGCACAAGAAGAAACACCCCGACTCCTCCGTCAACTTCGCTGAGTTCTCCAAGAAATGCTCCGAGAGGTGGAAGACCATGTCTGCAAAAGAAAAGGGAAAGTTTGAGGACATGGCTAAAGGTGATAAAGTCCGGTATGAACGCGAGATGAAAACCTACATACCACCAAAAGGAGAGACAAAGGGAAAGAAAAAGAAGGATCCAAATGCACCAAAAAGGCCGCCATCTGCCTTTTTCCTCTTTTGTTCTGAGCAACGTCCCCAGATAAAGAGCGAGACTCCTGGTCTTTCCATTGGTGACACGGCTAAGAAACTAGGAGAGCGGTGGTCAGAACAGACTTCTAAGGACAAGTTACCATTTGAGCAAAAGGCAGCCAAACTAAAGGAAAAATATGAGAAGGATGTTGCCGCATACCGGGCTAAGGGCAAAAGTGATGTCGGCAAGAAAGTTCCAGGAAGGCCGACGGGTTCTAAAAAGAAGGCAGAACCAGAAGATGATGATGATGAAGACGAGGATGACGAAGATGATGAGGAGGATGAAGATGATGAGGATGGATGATGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAAGTCACTATCAGTCAAAATAAAATCATTATTTGGCCTTCCAGCTGATATCCCCTAATGGTGAGTCGTAATACCTGGTCCTTAGCTGTTTTCTGGGCAGCTCCTGGCCCGGTCGAAAAAAAATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCAAGGGAGATCCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829027
dbEST ID: 79646729
Trimmed Sequence: TTCATCATCATCCTCATCATCTTCATCCTCCTCATCATCTTCGTCATCCTCGTCTTCATCATCATCATCTTCTGGTTCTGCCTTCTTTTTAGAACCCGTCGGCCTTCCTGGAACTTTCTTGCCGACATCACTTTTGCCCTTAGCCCGGTATGCGGCAACATCCTTCTCATATTTTTCCTTTAGTTTGGCTGCCTTTTGCTCAAATGGTAACTTGTCCTTAGAAGTCTGTTCTGACCACCGCTCTCCTAGTTTCTTAGCCGTGTCACCAATGGAAAGACCAGGAGTCTCGCTCTTTATCTGGGGACGTTGCTCAGAACAAAAGAGGAAAAAGGCAGATGGCGGCCTTTTTGGTGCATTTGGATCCTTCTTTTTCTTTCCCTTTGTCTCTCCTTTTGGTGGTATGTAGGTTTTCATCTCGCGTTCATACCGGACTTTATCACCTTTAGCCATGTCCTCAAACTTTCCCTTTTCTTTTGCAGACATGGTCTTCCACCTCTCGGAGCATTTCTTGGAGAACTCAGCGAAGTTGACGGAGGAGTCGGGGTGTTTCTTCTTGTGCTCTTCCCTGCACGTCTGCACAAAGTAGGCATAGGAGGACATCTTCCCCCAAGGCTTGTTAGGATCTCCCCTGGCCATGG
Full Trace Sequence: GGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCATCATCCTCATCATCTTCATCCTCCTCATCATCTTCGTCATCCTCGTCTTCATCATCATCATCTTCTGGTTCTGCCTTCTTTTTAGAACCCGTCGGCCTTCCTGGAACTTTCTTGCCGACATCACTTTTGCCCTTAGCCCGGTATGCGGCAACATCCTTCTCATATTTTTCCTTTAGTTTGGCTGCCTTTTGCTCAAATGGTAACTTGTCCTTAGAAGTCTGTTCTGACCACCGCTCTCCTAGTTTCTTAGCCGTGTCACCAATGGAAAGACCAGGAGTCTCGCTCTTTATCTGGGGACGTTGCTCAGAACAAAAGAGGAAAAAGGCAGATGGCGGCCTTTTTGGTGCATTTGGATCCTTCTTTTTCTTTCCCTTTGTCTCTCCTTTTGGTGGTATGTAGGTTTTCATCTCGCGTTCATACCGGACTTTATCACCTTTAGCCATGTCCTCAAACTTTCCCTTTTCTTTTGCAGACATGGTCTTCCACCTCTCGGAGCATTTCTTGGAGAACTCAGCGAAGTTGACGGAGGAGTCGGGGTGTTTCTTCTTGTGCTCTTCCCTGCACGTCTGCACAAAGTAGGCATAGGAGGACATCTTCCCCCAAGGCTTGTTAGGATCTCCCCTGGCCATGGTGCCAACTTTTTTTGTAAAAGTTTGGCATTATAAAAAAACATTTGCTCATCAATTTGTTGCCAACGAACAAGATCATTATAAAATCAAATAAAAAATCAATAATTTAGGGGCCCGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCATCATCCTCATCATCTTC