ORFeome > hmgn1 ORF2 – XORFeome v1.0

hmgn1 ORF2 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hmgn1
Gene ID: 6253615
Gene Page ID: 5782072
ORF Xenbase ID: 17279199

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054972
Original XGC clone length: 138

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ839558
dbEST ID: 79657260
Trimmed Sequence: ATGCCTAAGAGAAAGCAGGTAAACGCTGCTGATGCTGCAGATGCTAAAGATGAGCCCAAGAGAAGATCGGCACGGTTGTCGGCTAAACCAGCCCCAACAAAAGCTGAAGCAAGCCAAAAAAAGAGAAGGCACCGGTT
Full Trace Sequence: CTCCGGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTAAGAGAAAGCAGGTAAACGCTGCTGATGCTGCAGATGCTAAAGATGAGCCCAAGAGAAGATCGGCACGGTTGTCGGCTAAACCAGCCCCAACAAAAGCTGAAGCAAGCCAAAAAAAGAGAAGGCACCGGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGTCCGGGCGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCNCAATGAAAAAAATTACAAATATAGAAAATGATATCTGTGTACCTTCAGGCCTCCAATAGACCAAAGGGGGAGTAAAAGACTGGGCCGGGCTGCTACCCGGGGTTGCCGGGTGAGGCACACCGCGGAAACCAATGAACGCGCGAGCCTGGTGGACATAAGCATGTTCGGTTCGTAGGCTGCAATGCAGTAAAGTATGCACTCAGGCGAGTGGTCCGGAGCCTTGGGCCGATTTCGGGGTGGTAAGGGGTTATGTTGGTTTTCATGGTTTGTTAGACTGGTTTTTAGGGGGGACATCCTAGGGGCCGGGGTTTAATTAGAAAGAGCATAACCCCCCGGGGCGAAGGTTTCGGGTTTAGGAAAAAAAAAAAGAGGAGGGGGGGGGGGGGGTGCCCCCTAAAAAAAAATTAAAATTTTGAGGGGGGGGGGGCGGGGAACCCCCCAAAATTCCCCCCCCCTTTTTTTTGGGAGGGAGAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTAAGAGAAAGCAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839557
dbEST ID: 79657259
Trimmed Sequence: CCGGTGCCTTCTCTTTTTTTGGCTTGCTTCAGCTTTTGTTGGGGCTGGTTTAGCCGACAACCGTGCCGATCTTCTCTTGGGCTCATCTTTAGCATCTGCAGCATCAGCAGCGTTTACCTGCTTTCTCTTAGGCATGG
Full Trace Sequence: GAAAAGGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAACCGGTGCCTTCTCTTTTTTTGGCTTGCTTCAGCTTTTGTTGGGGCTGGTTTAGCCGACAACCGTGCCGATCTTCTCTTGGGCTCATCTTTAGCATCTGCAGCATCAGCAGCGTTTACCTGCTTTCTCTTAGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGACCTTAATACTGGACGTCGTTTAAAAAAAAAAAAACAAAAAAGAAAAAATTATCTCCTGGGCCTTGCGGGGGGAGAAAGAAAAAGCTGGATATATATGAAACGGGGCGGTTGATGGGAAGTGGTGTGGGGGGAGATGGACCGCGCAATAGGAAAAAAAAACGTATCCCGGGGTGAGATAATTTGGTTCAGGATCTGAGCTGGACCCGCGGGTACAAATGGTTTCCAAGAGACTGGTGCGGAGCCGTGGCACGGGCGTTTTGGTTGTTAATGGATCAATTGGTTTTTTTTCTTGGGTTTGTAACCCGGGTCTCCCACGCGACCCCTCAACGCCTCGGGGCGTTCTGTGATTTTGGGGGCTTAACCGGTCGGCTCACACTTCGGGCGGTCCCGCCCCAAAGAAAAAATTTTAAAGGAGAGGGGGGGGAGCGCGCCGAGACAGACAAATATCTACACATATATAGAGAGGAGGGGGTTGCCCCGCGCACAAAAACCCGAAAAAGCGACAACACAAAAGGGATGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGGTGCCTTCTCTTTTT