ORFeome > hmgn2 ORF1 – XORFeome v1.0

hmgn2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hmgn2
Gene ID: 1015278
Gene Page ID: 1015270
ORF Xenbase ID: 17279211

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054216
Original XGC clone length: 276

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ839289
dbEST ID: 79656991
Trimmed Sequence: ATGCCCAAGAGAAAGGCTGACGGAGACTCCAAGGTTGAGAAGTCCAAGGCAAAGGATGAGCCACAGAGGCAATCTGCCCGGTTATCCGCTAAGCCTGCTGCACCTAAACCAGAGCCCAAACCCAAGAAGGCTGCTCCTCCAAAGAAGGCTGATAAGGCACCCAAAGGCAAGAAAGGGAAGGCAGACTCTGGCAAAGATAGCAGTAATGCAGCTGAGAATGGAGAGGCCAAATCTGATCAGGCACAGAAGGCAGAGACAACTGGGGACACAAAGTT
Full Trace Sequence: GGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAAGAGAAAGGCTGACGGAGACTCCAAGGTTGAGAAGTCCAAGGCAAAGGATGAGCCACAGAGGCAATCTGCCCGGTTATCCGCTAAGCCTGCTGCACCTAAACCAGAGCCCAAACCCAAGAAGGCTGCTCCTCCAAAGAAGGCTGATAAGGCACCCAAAGGCAAGAAAGGGAAGGCAGACTCTGGCAAAGATAGCAGTAATGCAGCTGAGAATGGAGAGGCCAAATCTGATCAGGCACAGAAGGCAGAGACAACTGGGGACACAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGAACGTGTCAAAAAATCTCAAATGTTACATGACTCCTCAGAAGGGACAGAAAGGGAAGGAACAAATTAAATGGCTCCTACGGTGACGGGGGCCTCCCTCGTTTAATTGTGTGAGGGGTTCCCCCCCGGAATTAGGCAAGTTCGGGGGGACCGGTTTAAGGAAATGGGTAAACCGCCCGCACCCCGGGCGAAACTTGAGCTCAATTCCCTGGGGAACGGGGATGGCCGGGTTTTCGGGCTGGTTTAACCGGTTTTTTGTGTTTAAATCCTGGCGCGGCGCACCCCGGCGGGGGGGCATTCGGGGCGCGGGGGGGGGGGTTTTTTTTGGGAGGTTATATAAAAATTTTTTTTTTTTTTTGGTGGGGCGCCTAAACCACATTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAAGAGAAAGGCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839288
dbEST ID: 79656990
Trimmed Sequence: CTTTGTGTCCCCAGTTGTCTCTGCCTTCTGTGCCTGATCAGATTTGGCCTCTCCATTCTCAGCTGCATTACTGCTATCTTTGCCAGAGTCTGCCTTCCCTTTCTTGCCTTTGGGTGCCTTATCATCCTTCTTTGGAGGAGCAGCCTTCTTGGGTTTGGGCTCTGGTTTAGGTGCAGCAGGCTTACCGGATAACCGGGCAGATTGCCTCTGTGGCTCATCCTTTGCCTTGGACTTCTCGACCTTGTAGTCTCCGTCAGCCTTTCTCTTGGGCATGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAAACAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGTGTCCCCAGTTGTCTCTGCCTTCTGTGCCTGATCAGATTTGGCCTCTCCATTCTCAGCTGCATTACTGCTATCTTTGCCAGAGTCTGCCTTCCCTTTCTTGCCTTTGGGTGCCTTATCATCCTTCTTTGGAGGAGCAGCCTTCTTGGGTTTGGGCTCTGGTTTAGGTGCAGCAGGCTTACCGGATAACCGGGCAGATTGCCTCTGTGGCTCATCCTTTGCCTTGGACTTCTCGACCTTGTAGTCTCCGTCAGCCTTTCTCTTGGGCATGGTGCCAACTTTTTTGTACTAAGTTGGCATTATAAATAAGCATTGCTCATCGATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCCTTATTTGGGGCCCGACCATAAGACCAGACATCAATTTACAACGCCTTGACCTGGCTGCGACACGGCAAAACGCTAAATATACAATAGCTCTCTGGTTAACCGGGCTTCATTCAATGGTGGTGTGCACGTGCAACCCCGCCAAAGTACTACTCGCCCTTGACCCTTCATTATTGTCGCAGGGCGGCCCTGCGTGTCGCCCAACACGGTAGTAAAAAAGTGCGGATACGAGAACTGATTTACGCTTTTGTGTACCCATCTTCCGGGGGGGCGGGCCAACCTTAGGGTGGCAGGCCAATGTTTGAGGTACCTTTTTTTTTTTTCTGTTTTTGAAAAAAAATTTATCTTCACATGTTGTTTTCTAAAATTAAACGCACCCCCTTGTNANGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGTGTCCCCAGTTGT