ORFeome > hmox1 ORF1 – XORFeome v1.0

hmox1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hmox1
Gene ID: 6254707
Gene Page ID: 1002242
ORF Xenbase ID: 17279241

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108806
Original XGC clone length: 876

Human orthology & disease relationships

NCBI Entrez ID: 3162
Ensembl gene IDs: ENSG00000100292
Directly associated (OMIM) disease MIM numbers: 606963,614034
Indirectly associated (Lage, et al.) disease MIM numbers: 123320,125853,191100,192600,201750,207410,207900,215700,300291,300301,300584,308300,311250,601419,604765,606072,607801,608758

Library Location

Plate ID: GDExl11085
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ837723
dbEST ID: 79655425
Trimmed Sequence: ATGGATCCGTCTGCTAGCCAGCAATACAAAAGTACCCATGAAGACTTGTCTGAGGCCTTAAAAGAGGCAACAAAGGAAGTCCATGTTCAGGCAGAAAACACAGAGTTCATGAGGAACTTCCAGAAAGGACAAGTTTCCCTAGAGGAATTCAAGCTGGTTATGTCCTCGTTGTACTTCATCTATGAAGCTCTGGAGGAAGAGATTAACAGAAATAAGGATAATCCAGTATTTTCTCCTGTTTATTTCCCCCTGGAACTCCATCGTAAGAATGCGCTAGAAGTAGACCTTGAGTATTTCTATGGTCCACAATGGAGGAAGAAAATTATTTGTCCTCATTCAACAAAGAACTATGTTGACAGACTTCATCATGTTGGCCAAAAGGAGCCAGAGCTGCTCGTGTCTCATGCGTATACCCGTTATTTAGGAGACCTATCAGGTGGACAGGTTCTTAAAAAAATTGCTCAAAAGGCCTTGCAGCTTCCAGCCAGTGGTGAAGGTTTAGCATTCTTTACCTTCGACAATGTCACGAATGCAACTAAATTCAAACAACTCTACCGTTCCCGTATGAACTCCATTGAAACTGATGCATATGCCAAGAAAAGGATATTGGAAGAAGGCAAAACAGCATTTCTGCTTTATAACAAGCTGTTTGAGGAACTGCAGACCTTGTCACTAGCAACCTCCTCAAAATGGTAACCCTAGGGATGGAAGGCACAGATTTTACAAACCAAAGAACACCAAAAAAAAAAATTGGTAAACCATA
Full Trace Sequence: GCGAGGCCCACATAATAGAGTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCCGTCTGCTAGCCAGCAATACAAAAGTACCCATGAAGACTTGTCTGAGGCCTTAAAAGAGGCAACAAAGGAAGTCCATGTTCAGGCAGAAAACACAGAGTTCATGAGGAACTTCCAGAAAGGACAAGTTTCCCTAGAGGAATTCAAGCTGGTTATGTCCTCGTTGTACTTCATCTATGAAGCTCTGGAGGAAGAGATTAACAGAAATAAGGATAATCCAGTATTTTCTCCTGTTTATTTCCCCCTGGAACTCCATCGTAAGAATGCGCTAGAAGTAGACCTTGAGTATTTCTATGGTCCACAATGGAGGAAGAAAATTATTTGTCCTCATTCAACAAAGAACTATGTTGACAGACTTCATCATGTTGGCCAAAAGGAGCCAGAGCTGCTCGTGTCTCATGCGTATACCCGTTATTTAGGAGACCTATCAGGTGGACAGGTTCTTAAAAAAATTGCTCAAAAGGCCTTGCAGCTTCCAGCCAGTGGTGAAGGTTTAGCATTCTTTACCTTCGACAATGTCACGAATGCAACTAAATTCAAACAACTCTACCGTTCCCGTATGAACTCCATTGAAACTGATGCATATGCCAAGAAAAGGATATTGGAAGAAGGCAAAACAGCATTTCTGCTTTATAACAAGCTGTTTGAGGAACTGCAGACCTTGTCACTAGCAACCTCCTCAAAATGGTAACCCTAGGGATGGAAGGCACAGATTTTACAAACCAAAGAACACCAAAAAAAAAAATTGGTAAACCATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCGTCTGCTAGCCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837722
dbEST ID: 79655424
Trimmed Sequence: GAAAATATATAGTCCCATGAGAGTGATGAGTGCACAGCCAGCAATAAGAAACCAGCGAAGGAATGTTGTGGGCTGCTCCTCTGAGGAACTGTTGTTCTCTCTGTTGTCTGTTTTTGTAGGTCTACCATTTTCTGTCTTGGGTCCTCTGCTTCGTAATTCTGTTGCCTCAGTCCTAGTGTTACCATTCTGAGATGTTGCTAGTGACAAGGTCTGCAGTTCTTCAAACAGCTTGATATTAAGCAGGAATGCTGTTTTGGCCTCTTCCAATATCCTTTTCTTGGCATATGCATCAGTTTCAATGGAGTTCATACGGGAACGGTAGAGTTGTTTGAATTTAGTTGCATTCGTGACATTGTCGAAGGTAAAGAATGCTAAACCTTCACCACTGGCTGGAAGCTGCGGGGCCTTTTGAGCAGTTTTTTTAAGAACCTGTCCGGCTGAGAGGTCTCGTAAATAACGGGGAGACGCATGAGAGGCGAGCAGCGCTGGCTCGGTTTGTGCGGCGTGATGAAGTCTGTCGGCATAGTTCTATGTTGAGAGGGGACGGGGAAATTTCTTCCGCCATAGGGGGGGGAGGAAATAGAGATACTCTGCGTCTAGGTGGTGGATATGAGGAGATTGCGGGGGGGGGGGGACAGAGGGGGGGAAGGAGTGGGGGGTTTCGGGTAGCGCTTCCTCGAACCGCGCCAGATAAGGGGGAGGGAAAAAGAGCGACTTGAGTGGCGCGGGCGAAGGGGGGGGGGGGGGAGTGGGGGGGGGGCGGGGGGGTTGTGGGGGGGGGGGAGAGGGGGTGGGGGGGGGGGGGGGTTGGGGGGGGGGGGGTGGGGGGGGGGGGGGTGGGGGGAGGGGGGGGGAGACCAGGGCGGGGGGGCGTGTGGGGGAGTAAGGGGGGGGGGGGGGGGAGGGGGGGCGGGTCGGGGGTGGAAAAAAAAAAAAAAAGAAAAGGAGAAAAAAAGGGAAAGAAGGAACACAAAAGAAGGGGCACGGCAAGGGGTATTAGAGGACGGGGCGGGCGGGAGAGGGGAGGAGGACCAGTAAGAAGAGGAGGGCGGGGGGGCCGGCCGAGAAGGAACGCGCGTACGGAGGGGCGGGAGGAGAGGGGGGGACGGGACGGAGCGCAGCCCGGGCACGGCACGACCGCGCCGGGCGCGAGGGGGGGAGGGGGNGGGGGGGGAAG
Full Trace Sequence: GGCCGGGGAAACAGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAATATATAGTCCCATGAGAGTGATGAGTGCACAGCCAGCAATAAGAAACCAGCGAAGGAATGTTGTGGGCTGCTCCTCTGAGGAACTGTTGTTCTCTCTGTTGTCTGTTTTTGTAGGTCTACCATTTTCTGTCTTGGGTCCTCTGCTTCGTAATTCTGTTGCCTCAGTCCTAGTGTTACCATTCTGAGATGTTGCTAGTGACAAGGTCTGCAGTTCTTCAAACAGCTTGATATTAAGCAGGAATGCTGTTTTGGCCTCTTCCAATATCCTTTTCTTGGCATATGCATCAGTTTCAATGGAGTTCATACGGGAACGGTAGAGTTGTTTGAATTTAGTTGCATTCGTGACATTGTCGAAGGTAAAGAATGCTAAACCTTCACCACTGGCTGGAAGCTGCGGGGCCTTTTGAGCAGTTTTTTTAAGAACCTGTCCGGCTGAGAGGTCTCGTAAATAACGGGGAGACGCATGAGAGGCGAGCAGCGCTGGCTCGGTTTGTGCGGCGTGATGAAGTCTGTCGGCATAGTTCTATGTTGAGAGGGGACGGGGAAATTTCTTCCGCCATAGGGGGGGGAGGAAATAGAGATACTCTGCGTCTAGGTGGTGGATATGAGGAGATTGCGGGGGGGGGGGGACAGAGGGGGGGAAGGAGTGGGGGGTTTCGGGTAGCGCTTCCTCGAACCGCGCCAGATAAGGGGGAGGGAAAAAGAGCGACTTGAGTGGCGCGGGCGAAGGGGGGGGGGGGGGAGTGGGGGGGGGGCGGGGGGGTTGTGGGGGGGGGGGAGAGGGGGTGGGGGGGGGGGGGGGTTGGGGGGGGGGGGGTGGGGGGGGGGGGGGTGGGGGGAGGGGGGGGGAGACCAGGGCGGGGGGGCGTGTGGGGGAGTAAGGGGGGGGGGGGGGGGAGGGGGGGCGGGTCGGGGGTGGAAAAAAAAAAAAAAAGAAAAGGAGAAAAAAAGGGAAAGAAGGAACACAAAAGAAGGGGCACGGCAAGGGGTATTAGAGGACGGGGCGGGCGGGAGAGGGGAGGAGGACCAGTAAGAAGAGGAGGGCGGGGGGGCCGGCCGAGAAGGAACGCGCGTACGGAGGGGCGGGAGGAGAGGGGGGGACGGGACGGAGCGCAGCCCGGGCACGGCACGACCGCGCCGGGCGCGAGGGGGGGAGGGGGNGGGGGGGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAATATATAGTCCCATGAGAGT