ORFeome > hnmt ORF1 – XORFeome v1.0

hnmt ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hnmt
Gene ID: 6253788
Gene Page ID: 1001068
ORF Xenbase ID: 17279277

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054281
Original XGC clone length: 882

Human orthology & disease relationships

NCBI Entrez ID: 3176
Ensembl gene IDs: ENSG00000150540
Directly associated (OMIM) disease MIM numbers: 600807
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,203100,230350,231300,248600,268300,300000,600121,601003,606952,608643,608902,609535

Library Location

Plate ID: GDExl11002
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ839369
dbEST ID: 79657071
Trimmed Sequence: ATGGATTCCGGGCTGAGATCTTTACTCTCCGACCACAGCAGATATGTGGAATCATTCCGGCTGTTCCTGCAAAACTCCACAGAGCACCAGTGCATGCAGCACTTTATTGAGACCAAGCTACCCGACATCATCTCAAGTATAGGAAATGACAAGCCGGTGATTGACGTCCTAGGCATTGGAAGTGGATCAGGAGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGAGTCTCCATAAACAACCAGATTGTGGAACCAAGTGCTGAGCAAATCCTTGGCTACAAGGAGCGTGTGGCAAAGGCCCCAAATCTGGGATATGTCACCTTCTCCTGGCATCACCAGACCTCAAGTGAATTTGAACACAGAGTCACTGAAGATAAACAGATGACAAAGTATGATTTTATCCATATGATACAGATGTTATATTATGTAAAGGATGTCCCAGGAACCTTAAAATTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTTGTATCAGGTAACAGTGGGTGGGCCCCACTATGGAAGAAATATGGGCAGCGGCTACCTCTAAATGACCTCTGTCTGTACGTTACTGCGGGAGACATTGCAGAGATGCTTAGTTCAATGGGCGCCCGGTTCCAGAGTCACGAACTGCAGTCGGACATGGACATCACTAAATGTTTCATCGAAGGGGGACAAAAAATGGGGAACTTCTGGCTGGACTTTCTGAACCGAAAACGTTGGGAATTTTAGGAAAAAAGGCCTCCTGGCTTAAGCCTCAGGGGGAATCAAAATTAATCCGGGTTGAA
Full Trace Sequence: CGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTCCGGGCTGAGATCTTTACTCTCCGACCACAGCAGATATGTGGAATCATTCCGGCTGTTCCTGCAAAACTCCACAGAGCACCAGTGCATGCAGCACTTTATTGAGACCAAGCTACCCGACATCATCTCAAGTATAGGAAATGACAAGCCGGTGATTGACGTCCTAGGCATTGGAAGTGGATCAGGAGAGATTGACCTGCAGATGATTGCCAAGATACAGGCTCGATGGCCAGGAGTCTCCATAAACAACCAGATTGTGGAACCAAGTGCTGAGCAAATCCTTGGCTACAAGGAGCGTGTGGCAAAGGCCCCAAATCTGGGATATGTCACCTTCTCCTGGCATCACCAGACCTCAAGTGAATTTGAACACAGAGTCACTGAAGATAAACAGATGACAAAGTATGATTTTATCCATATGATACAGATGTTATATTATGTAAAGGATGTCCCAGGAACCTTAAAATTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTTGTATCAGGTAACAGTGGGTGGGCCCCACTATGGAAGAAATATGGGCAGCGGCTACCTCTAAATGACCTCTGTCTGTACGTTACTGCGGGAGACATTGCAGAGATGCTTAGTTCAATGGGCGCCCGGTTCCAGAGTCACGAACTGCAGTCGGACATGGACATCACTAAATGTTTCATCGAAGGGGGACAAAAAATGGGGAACTTCTGGCTGGACTTTCTGAACCGAAAACGTTGGGAATTTTAGGAAAAAAGGCCTCCTGGCTTAAGCCTCAGGGGGAATCAAAATTAATCCGGGTTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTCCGGGCTGAGATCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839368
dbEST ID: 79657070
Trimmed Sequence: ATCCGCCTCCACTACAATCACACTAAGGTTGTTGTTAAAAATAACCTTCCCATCCTTTGTTGTACTGCACCTGGGACTTTTTAGGTCACAGATAATCTGATCCCTGAGCTCAGCAGGAGCATTTTTCCTAAAATCACACGTCTCGGTCAGAAAGTCCAGCAGAAGTTCCCCATTTTTGTCCCCCTCGATGAAACATTTAGTGATGTCCATGTCCGACTGCAGTTCGTGACTCTGGAACCGGGCGCCCATTGAACTAAGCATCTCTGCAATGTCTCCCGCAGTAACGTACAGACAGAGGTCATTTAGAGGTAGCCGCTGCCCATATTTCTTCCATAGTGGGGCCCACCCACTGTTACCTGATACAAGAATGATCAAGAGCTTCCCATTGGGTGCCAGGCAGCTTTTAAAGAATTTTAAGGTTCCTGGGACATCCTTTACATAATATAACATCTGTATCATATGGATAAAATCATACTTTGTCATCTGTTTATCTTCAGTGACTCTGTGTTCAAATTCACTTGAGGTCTGGTGATGCCAGGAGAAGGTGACATATCCNAGATTTGGGGCCTTTGCCACACGCTCCTTGTAGCCCAGGATTTGCTCAACACTTGGTTCCACAATCTGGTTTGTTAATGGAAACTCCTGGCCCATCGAGCCCTGGTATCTGGGCAAATCTTCTTGCAAGTTCCATCTCCTTCCTGAAATAACTTTCCAAATCCCTAAGAAACATCAAATCAACCGGCCTTTGTTCATTTCTCCATAAACCTTTTA
Full Trace Sequence: GCGGAATAAGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCGCCTCCACTACAATCACACTAAGGTTGTTGTTAAAAATAACCTTCCCATCCTTTGTTGTACTGCACCTGGGACTTTTTAGGTCACAGATAATCTGATCCCTGAGCTCAGCAGGAGCATTTTTCCTAAAATCACACGTCTCGGTCAGAAAGTCCAGCAGAAGTTCCCCATTTTTGTCCCCCTCGATGAAACATTTAGTGATGTCCATGTCCGACTGCAGTTCGTGACTCTGGAACCGGGCGCCCATTGAACTAAGCATCTCTGCAATGTCTCCCGCAGTAACGTACAGACAGAGGTCATTTAGAGGTAGCCGCTGCCCATATTTCTTCCATAGTGGGGCCCACCCACTGTTACCTGATACAAGAATGATCAAGAGCTTCCCATTGGGTGCCAGGCAGCTTTTAAAGAATTTTAAGGTTCCTGGGACATCCTTTACATAATATAACATCTGTATCATATGGATAAAATCATACTTTGTCATCTGTTTATCTTCAGTGACTCTGTGTTCAAATTCACTTGAGGTCTGGTGATGCCAGGAGAAGGTGACATATCCNAGATTTGGGGCCTTTGCCACACGCTCCTTGTAGCCCAGGATTTGCTCAACACTTGGTTCCACAATCTGGTTTGTTAATGGAAACTCCTGGCCCATCGAGCCCTGGTATCTGGGCAAATCTTCTTGCAAGTTCCATCTCCTTCCTGAAATAACTTTCCAAATCCCTAAGAAACATCAAATCAACCGGCCTTTGTTCATTTCTCCATAAACCTTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCGCCTCCACTACAATCA