ORFeome > hnrnpa1 ORF1 – XORFeome v1.0

hnrnpa1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hnrnpa1
Gene ID: 493967
Gene Page ID: 493962
ORF Xenbase ID: 17279295

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045260
Original XGC clone length: 1200

Human orthology & disease relationships

NCBI Entrez ID: 3178
Ensembl gene IDs: ENSG00000135486,ENSG00000239345
Directly associated (OMIM) disease MIM numbers: 615424,615426
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,154500,162210,164300,182290,193520,214450,215600,253300,253400,253550,256710,300590,303600,600334,603689,604145,607841,608807,608808,609065,609227

Library Location

Plate ID: GDExl11008
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ823591
dbEST ID: 79641293
Trimmed Sequence: ATGCACAAGTCCGAGGCACCCAAGGAGCCAGAGCAACTCCGCAAGCTGTTCATTGGAGGCCTGAGTTTTGAAACAACTGACGAAAGTCTTCGTGAGCACTTTGAGCAATGGGGCGCCCTAACAGACTGTGTGGTTATGAGAGATCCAAACTCAAAACGTTCCCGTGGCTTTGGATTTGTAACATACTCCTCAACAGACGAAGTAGATGCTGCCATGACTGCTCGGCCGCATAAGGTGGATGGACGAGTGGTTGAACCTAAAAGGGCTGTCTCTAGAGAAGATTCTTCTAGGCCTGGTGCACACCTCACCGTTAAGAAGATCTTTGTAGGTGGTATAAAGGAGGACACAGAAGAACACCATTTACGAGAATATTTTGAGCAATATGGCAAAATTGAAGTCATAGAGATAATGACCGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCATTTGTCACATTTGAAGACCATGATTCAGTTGACAAGATTGTCATCCAGAAATATCACACTGTCAACAACCACAACTGTGAAGTGCGTAAGGCACTCTCCAAACAGGAAATGTCAAGTGTTTCTGGCAGTCAAAGAGGACGTGGTGGCTCTGGAAACTATGGTGGCCGTGGAGGGTTTGGTAATGACAACTTTGGAGGTCGTGGTGGAAACTTTGGTGGCAACAGAGGGGGTGGATTTGGTAACCGAAGTTATGGGG
Full Trace Sequence: GCCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCACAAGTCCGAGGCACCCAAGGAGCCAGAGCAACTCCGCAAGCTGTTCATTGGAGGCCTGAGTTTTGAAACAACTGACGAAAGTCTTCGTGAGCACTTTGAGCAATGGGGCGCCCTAACAGACTGTGTGGTTATGAGAGATCCAAACTCAAAACGTTCCCGTGGCTTTGGATTTGTAACATACTCCTCAACAGACGAAGTAGATGCTGCCATGACTGCTCGGCCGCATAAGGTGGATGGACGAGTGGTTGAACCTAAAAGGGCTGTCTCTAGAGAAGATTCTTCTAGGCCTGGTGCACACCTCACCGTTAAGAAGATCTTTGTAGGTGGTATAAAGGAGGACACAGAAGAACACCATTTACGAGAATATTTTGAGCAATATGGCAAAATTGAAGTCATAGAGATAATGACCGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCATTTGTCACATTTGAAGACCATGATTCAGTTGACAAGATTGTCATCCAGAAATATCACACTGTCAACAACCACAACTGTGAAGTGCGTAAGGCACTCTCCAAACAGGAAATGTCAAGTGTTTCTGGCAGTCAAAGAGGACGTGGTGGCTCTGGAAACTATGGTGGCCGTGGAGGGTTTGGTAATGACAACTTTGGAGGTCGTGGTGGAAACTTTGGTGGCAACAGAGGGGGTGGATTTGGTAACCGAAGTTATGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACAAGTCCGAGGCACCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828889
dbEST ID: 79646591
Trimmed Sequence: AAACCTCCTCCCACCGCCATATCCGCTACTGCTGCTACCAAACCCTCCGCCATAGCCACCTGCATACGGTGCAGAATTCCTGCCACCACCATAATTTCCACCTTTCATTGGGCCAAAGCTGGACGAGGACTGATTGTTGTAGTTGCCGAAGTCATTATATCCCCCGCTCCCACCAAAGTTACCCCCAGAACCACTGCCTCCTCCATTATAGCCATCGTATCCTCCATTCCCACCTCCTTGGCCACCACCATATCCTCCGCCTTGGCCGCCACCATATCCACCGCCTTGGCCGCCACCATAACCACCACTTTGGCCGCCACCATATCCACCGCCGTGGCCGCCACCACCATATCCACCGCCTTGGCCGCCACCACCATATCCACCGCCATGGCTGCCACCACCATATCCACCGCCATGGCTGCCACCATATCCTCTGTTACCACCATAGTAAGGAGGACTGCCACCAAAACCACCATCATTGCCAAAGCCATCTCCACCATAACTTCGGTTACCAAATCCACCCCCTCTGTTGCCACCCAAGTTTCCACCACGACCCTCCAAGTTGTCATTTACCAACCCTTCACGGCCACCACAGTTTCCCCAAGCCACCACTTACTCATTGACTGCCAGGAGAAACTTGAACATTTCCTGGTCGGAAGAGTGGCCCTACTCACTTT
Full Trace Sequence: CTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACCTCCTCCCACCGCCATATCCGCTACTGCTGCTACCAAACCCTCCGCCATAGCCACCTGCATACGGTGCAGAATTCCTGCCACCACCATAATTTCCACCTTTCATTGGGCCAAAGCTGGACGAGGACTGATTGTTGTAGTTGCCGAAGTCATTATATCCCCCGCTCCCACCAAAGTTACCCCCAGAACCACTGCCTCCTCCATTATAGCCATCGTATCCTCCATTCCCACCTCCTTGGCCACCACCATATCCTCCGCCTTGGCCGCCACCATATCCACCGCCTTGGCCGCCACCATAACCACCACTTTGGCCGCCACCATATCCACCGCCGTGGCCGCCACCACCATATCCACCGCCTTGGCCGCCACCACCATATCCACCGCCATGGCTGCCACCACCATATCCACCGCCATGGCTGCCACCATATCCTCTGTTACCACCATAGTAAGGAGGACTGCCACCAAAACCACCATCATTGCCAAAGCCATCTCCACCATAACTTCGGTTACCAAATCCACCCCCTCTGTTGCCACCCAAGTTTCCACCACGACCCTCCAAGTTGTCATTTACCAACCCTTCACGGCCACCACAGTTTCCCCAAGCCACCACTTACTCATTGACTGCCAGGAGAAACTTGAACATTTCCTGGTCGGAAGAGTGGCCCTACTCACTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACCTCCTCCCACCGCCA