ORFeome > hnrnpab ORF1 – XORFeome v1.0

hnrnpab ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hnrnpab
Gene ID: 6043063
Gene Page ID: 6042554
ORF Xenbase ID: 17279307

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043814
Original XGC clone length: 975

Human orthology & disease relationships

NCBI Entrez ID: 3182
Ensembl gene IDs: ENSG00000197451
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 115310,171300,252011,605373,607482

Library Location

Plate ID: GDExl11013
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ824097
dbEST ID: 79641799
Trimmed Sequence: ATGTCCGACACCGAGCAGCAGTGTCTAGAAACGAACGCCGAGAACGGCCACGAAGCTTGCGATGCGGAGGCAGCCGAGGATAAGGCGCCCGCAGGCCAAAACGGCGCGGAAGGCGAACAGATAAACGCGAGCAAAGGCGAAGAGGACGCAGGCTGCGTAGCTGATATTTCTTCCCCTTTAACTGAAGGAGTGAAAATGTTTGTTGGTGGCTTGAGCTGGGATACAAGCAAAAAGGACTTGAAAGACTACTTTGCAAAGTTTGGTGAGGTGTCTGACTGCACAATTAAGATGGACCCAAATACAGGAAGATCTCGAGGTTTTGGATTTATTCTGTTTAAAGATGCGGAGAGTGTGGACAAGGTATTGGAGCATAAAGAACACAGACTAGATGGCAGATTAATTGATCCCAAGAAGGCCATGGCAATGAAAAAGGATCCAATAAAGAAAATATTTGTTGGTGGGCTCAATCCAGAAGCAGGAGAAGACCAAATAAGAGAATACTTTGAAACTTTTGGAGAGATTGAAGCGATTGAGCTTCCAATGGATCCAAAAACAAACAAGAGGAGGGGCTTTGTTTTCATTACATTTAAGGAAGAGGATCCCGTGAAAAAGATCTTGGAGAANAAATTCCACAATGTCAGTGGAAGCAAGTGTGAGATAAAGATTGCACAACCAAAAGAAGTGTATCAGGCACAGTATGGCGGCAGAGGTGGTAGCTTTGGTGGAAAGAGGCGCAGAAGGGGGGGAAGGGTCAGGGCAAAAATGGGAATCAAGGCTACAATTACTGGAAATCAGGGCTATTGGCAACCAAGGGTTTATGGAAGCCATGGGAACGGCCAG
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGACACCGAGCAGCAGTGTCTAGAAACGAACGCCGAGAACGGCCACGAAGCTTGCGATGCGGAGGCAGCCGAGGATAAGGCGCCCGCAGGCCAAAACGGCGCGGAAGGCGAACAGATAAACGCGAGCAAAGGCGAAGAGGACGCAGGCTGCGTAGCTGATATTTCTTCCCCTTTAACTGAAGGAGTGAAAATGTTTGTTGGTGGCTTGAGCTGGGATACAAGCAAAAAGGACTTGAAAGACTACTTTGCAAAGTTTGGTGAGGTGTCTGACTGCACAATTAAGATGGACCCAAATACAGGAAGATCTCGAGGTTTTGGATTTATTCTGTTTAAAGATGCGGAGAGTGTGGACAAGGTATTGGAGCATAAAGAACACAGACTAGATGGCAGATTAATTGATCCCAAGAAGGCCATGGCAATGAAAAAGGATCCAATAAAGAAAATATTTGTTGGTGGGCTCAATCCAGAAGCAGGAGAAGACCAAATAAGAGAATACTTTGAAACTTTTGGAGAGATTGAAGCGATTGAGCTTCCAATGGATCCAAAAACAAACAAGAGGAGGGGCTTTGTTTTCATTACATTTAAGGAAGAGGATCCCGTGAAAAAGATCTTGGAGAANAAATTCCACAATGTCAGTGGAAGCAAGTGTGAGATAAAGATTGCACAACCAAAAGAAGTGTATCAGGCACAGTATGGCGGCAGAGGTGGTAGCTTTGGTGGAAAGAGGCGCAGAAGGGGGGGAAGGGTCAGGGCAAAAATGGGAATCAAGGCTACAATTACTGGAAATCAGGGCTATTGGCAACCAAGGGTTTATGGAAGCCATGGGAACGGCCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGACACCGAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829405
dbEST ID: 79647107
Trimmed Sequence: GTATGGCTTGTAGTTATTCTGGTGGCTCCCACGTCTTGGAGCTTTACCATAGTTTGCACTGCCCTGACTGTAGTCATAGCCTGGTCCATATCCATAATAGCCATAACCAGAATAATCATAATTTCCATAGCCTCCGTATCCTTGCTGTCCATAGCCTCCATAACCTTGGTTGCCATAGCCCTGATTCCAGTAATTGTAGCCTTGATTCCAATTTTGGCCTTGACCTTTCCCCCCTCTGCCGCCTCTTCCACCAAAGCTACCACCTCTGCCGCCATACTGTTGCTGATACACTTCTTTTGGTTGTGCAATCTTTATCTCACACTTGCTTCCACTGACATTGTGGAATTTTTTCTCCAAGATCTTTTTCACGGGATCCTCTTCCTTAAATGTAATGAAAACAAAGCCCCTCCTCTTGTTTGTTTTTGGATCCATTGGAAGCTCAATCGCTTCAATCTCTCCAAAAGTTTCAAAGTATTCTCTTATTTGGTCTTCTCCTGCTTCTGGATTGAGCCCACCAACAAATATTTTCTTTATTGGATCCTTTTTCATTGCCATGGCCTTCTTGGGATCAATTAATCTGGCATCTAGTCTGTGTTCTTTATGCTCCAATACCTTGTCCACACTCTCCCGCACCTTTAAACGAAATAAATCCCAAACCTCCAGAACTTCCCGGAATTTGGGTTCCTTCTTAAATGGTGCATCCAAACACCTCACCAAAACTTTGGCAAAGTAAGTCTTTTCAAAGTTCCCTTTTTTTCCTGGGTAT
Full Trace Sequence: GGGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATGGCTTGTAGTTATTCTGGTGGCTCCCACGTCTTGGAGCTTTACCATAGTTTGCACTGCCCTGACTGTAGTCATAGCCTGGTCCATATCCATAATAGCCATAACCAGAATAATCATAATTTCCATAGCCTCCGTATCCTTGCTGTCCATAGCCTCCATAACCTTGGTTGCCATAGCCCTGATTCCAGTAATTGTAGCCTTGATTCCAATTTTGGCCTTGACCTTTCCCCCCTCTGCCGCCTCTTCCACCAAAGCTACCACCTCTGCCGCCATACTGTTGCTGATACACTTCTTTTGGTTGTGCAATCTTTATCTCACACTTGCTTCCACTGACATTGTGGAATTTTTTCTCCAAGATCTTTTTCACGGGATCCTCTTCCTTAAATGTAATGAAAACAAAGCCCCTCCTCTTGTTTGTTTTTGGATCCATTGGAAGCTCAATCGCTTCAATCTCTCCAAAAGTTTCAAAGTATTCTCTTATTTGGTCTTCTCCTGCTTCTGGATTGAGCCCACCAACAAATATTTTCTTTATTGGATCCTTTTTCATTGCCATGGCCTTCTTGGGATCAATTAATCTGGCATCTAGTCTGTGTTCTTTATGCTCCAATACCTTGTCCACACTCTCCCGCACCTTTAAACGAAATAAATCCCAAACCTCCAGAACTTCCCGGAATTTGGGTTCCTTCTTAAATGGTGCATCCAAACACCTCACCAAAACTTTGGCAAAGTAAGTCTTTTCAAAGTTCCCTTTTTTTCCTGGGTAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATGGCTTGTAGTTATTCTGGT