ORFeome > hnrnpdl ORF1 – XORFeome v1.0

hnrnpdl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hnrnpdl
Gene ID: 866408
Gene Page ID: 495015
ORF Xenbase ID: 17279325

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045124
Original XGC clone length: 882

Human orthology & disease relationships

NCBI Entrez ID: 9987
Ensembl gene IDs: ENSG00000152795
Directly associated (OMIM) disease MIM numbers: 609115
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11015
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ824242
dbEST ID: 79641944
Trimmed Sequence: ATGGCCGGATTCGGTGCAGCTCCAGACTTCAATGAAGGGTCAAAGATCAATGCCAGCAAAAACCAACAGGATGAAGGTAAAATGTTCATTGGAGGCCTTAGTTGGGATACAAGCAAGAAAGACCTAACCGAGTATCTGTCTCGGTTTGGGGAGGTGTTGGATTGCACAATCAAAACTGACCCCGTGACTGGGCGATCAAGAGGATTCGGCTTTGTTCTCTTCAAAGATGCTGTGAGCGTTGACAAAGTTCTTGAAACAAACGAGCATAAACTAGATGGCAAGCTTATTGATCCAAAAAGAGCTAAGGCACTGAAAGGCAAAGAGCCCCCCAAGAAAGTCTTTGTTGGTGGACTCAGTCCTGAAACAACAGAGGAGCAGATCAAGCAGTATTTTGGTGGATTTGGAGAAATTGAAAATATTGAACTGCCAATTGACACAAAAACAAACGAAAGGAGAGGCTTTTGTTTTGTCACCTACACAGGTGAAGAACCAGTAAAGAAGCTTTTGGAAAGCCGGTTCCACCAAATTGGTACAGGAAAGTGTGAAATAAAAGCTGCACAGCCCAAAGAAGTCTACAGACAACAACAACAGAAGCAGCAGAGGGGAGGAAGAGGAGCAGTCNACTGGAAGGGGTGGTACCAGAGGAAGAGGCAGAGGTCAAGGTTGGAATCAGGCTACAACACTACTATGATCAAACTATGGCGGATATGGAAAACATGGTTCCTATGGTGATCAGAACTATACAGCTATAGTGGGTATGAATACTCTGGGGTACAGCTATGGAAATTAACCCAGGATAATAACTGGAAAATAGTGGGGCGACAAAAAACAAATA
Full Trace Sequence: CAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGGATTCGGTGCAGCTCCAGACTTCAATGAAGGGTCAAAGATCAATGCCAGCAAAAACCAACAGGATGAAGGTAAAATGTTCATTGGAGGCCTTAGTTGGGATACAAGCAAGAAAGACCTAACCGAGTATCTGTCTCGGTTTGGGGAGGTGTTGGATTGCACAATCAAAACTGACCCCGTGACTGGGCGATCAAGAGGATTCGGCTTTGTTCTCTTCAAAGATGCTGTGAGCGTTGACAAAGTTCTTGAAACAAACGAGCATAAACTAGATGGCAAGCTTATTGATCCAAAAAGAGCTAAGGCACTGAAAGGCAAAGAGCCCCCCAAGAAAGTCTTTGTTGGTGGACTCAGTCCTGAAACAACAGAGGAGCAGATCAAGCAGTATTTTGGTGGATTTGGAGAAATTGAAAATATTGAACTGCCAATTGACACAAAAACAAACGAAAGGAGAGGCTTTTGTTTTGTCACCTACACAGGTGAAGAACCAGTAAAGAAGCTTTTGGAAAGCCGGTTCCACCAAATTGGTACAGGAAAGTGTGAAATAAAAGCTGCACAGCCCAAAGAAGTCTACAGACAACAACAACAGAAGCAGCAGAGGGGAGGAAGAGGAGCAGTCNACTGGAAGGGGTGGTACCAGAGGAAGAGGCAGAGGTCAAGGTTGGAATCAGGCTACAACACTACTATGATCAAACTATGGCGGATATGGAAAACATGGTTCCTATGGTGATCAGAACTATACAGCTATAGTGGGTATGAATACTCTGGGGTACAGCTATGGAAATTAACCCAGGATAATAACTGGAAAATAGTGGGGCGACAAAAAACAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGATTCGGTGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829566
dbEST ID: 79647268
Trimmed Sequence: GTAAGGCTGGTAGTTGTTTTGATGGTTTCCTCCACCTCTTGCTTTGCCGTATGTGCTTTGTTGCCCACTATATTCAGTATATCCTGGGTTATATCCATAGCTGTACCCAGAGTAATCATAACCACTATAGCTGTTATAGTCTTGATCACCATAGGAACCATTGTTTCCATATCCGCCATAGTTTTGATCATAGTAGTTGTTGTAGCCTTGATTCCAACCTTGACCTCTGCCTCTTCCTCTGGTACCACCCCTTCCAGTGACTGCTCCTCTTCCTCCCCTCTGCTGCTTCTGTTGTTGTTGTCTGTAGACTTCTTTGGGCTGTGCAGCTTTTATTTCACACTTTCCTGTACCAATTTGGTGGAACCGGCTTTCCAAAAGCTTCTTTACTGGTTCTTCACCTGTGTAGGTGACAAAACAAAAGCCTCTCCTTTCGTTTGTTTTTGTGTCAATTGGCAGTTCAATATTTTCAATTTCTCCAAATCCACCAAAATACTGCTTGATCTGCTCCTCTGTTGTTTCAGGACTGAGTCCACCAACAAAGACTTTCTTGGGGGGCTCTTTGCCTTTCAGTGCCTTAGCTCTTTTTGGAATCATAAACTTGCCATCTAGTTTATGCTCGTTTGTTTCAAGAACTTTGTCAACGCTCACACCATCTTTGAAGAGAACAAAGCCAAAATCTTCTTGATCCGCCCAGTCCACGGGTTCAGTTTTTGAATTGTGCCAATCCAACACCCTCCCCCAACCCGAA
Full Trace Sequence: CCGCGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAAGGCTGGTAGTTGTTTTGATGGTTTCCTCCACCTCTTGCTTTGCCGTATGTGCTTTGTTGCCCACTATATTCAGTATATCCTGGGTTATATCCATAGCTGTACCCAGAGTAATCATAACCACTATAGCTGTTATAGTCTTGATCACCATAGGAACCATTGTTTCCATATCCGCCATAGTTTTGATCATAGTAGTTGTTGTAGCCTTGATTCCAACCTTGACCTCTGCCTCTTCCTCTGGTACCACCCCTTCCAGTGACTGCTCCTCTTCCTCCCCTCTGCTGCTTCTGTTGTTGTTGTCTGTAGACTTCTTTGGGCTGTGCAGCTTTTATTTCACACTTTCCTGTACCAATTTGGTGGAACCGGCTTTCCAAAAGCTTCTTTACTGGTTCTTCACCTGTGTAGGTGACAAAACAAAAGCCTCTCCTTTCGTTTGTTTTTGTGTCAATTGGCAGTTCAATATTTTCAATTTCTCCAAATCCACCAAAATACTGCTTGATCTGCTCCTCTGTTGTTTCAGGACTGAGTCCACCAACAAAGACTTTCTTGGGGGGCTCTTTGCCTTTCAGTGCCTTAGCTCTTTTTGGAATCATAAACTTGCCATCTAGTTTATGCTCGTTTGTTTCAAGAACTTTGTCAACGCTCACACCATCTTTGAAGAGAACAAAGCCAAAATCTTCTTGATCCGCCCAGTCCACGGGTTCAGTTTTTGAATTGTGCCAATCCAACACCCTCCCCCAACCCGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAGGCTGGTAGTTGTTTTGA