ORFeome > homer3 ORF1 – XORFeome v1.0

homer3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: homer3
Gene ID: 962127
Gene Page ID: 962122
ORF Xenbase ID: 17279397

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045262
Original XGC clone length: 1074

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ823601
dbEST ID: 79641303
Trimmed Sequence: ATGTCTTCTATCAATAACAGGGAGCAGCCAATTTTTAGCACCCGGGCTCATGTGTTTCAGATCGACCCAGTCACAAAAAAGAACTGGCTTCCGGCCAGCAAACATGCGGTCACAGTATCATACTTCTACGATGCTACAAGGAATGTATACCGCATCATCAGTGTGGGGGGCACCAAGGCCATCATCAACAGTACCATAACTCCAAACATGACATTTACCAAAACCTCACAGAAGTTCGGACAATGGGCCGACAGTCGTGCCAACACTGTGTATGGATTGGGCTTCGCTTCAGAGCAGAATTTATTTCAGTTTGCAGAGAAGTTCCAGGAAGTGAGGGAAGCTGCCCGACTGGCAAGGGAGAGATCTCAGGACAAGACTGAGCTTACAAACCCTGCACTTAATATTACTTCTCAGCAGGTACTTCCTTCTCCTATTATCAGTGCCAATGGACCAGGGGATGACAAGCTGTTTCGGAGCCAGAGTGCAGAGATGGAACTTAGCACAGAAAGGGAACGTGTTAAGAAGATGCTCTCCGAAGGCTCAGTGTGTGAAGTTCAGTGGGAAGCCGAGTTCTTCAGTCTCCAGGATAATAACAACAAGTTGGTGGCAGCCCTTCGAGAAGCTAATGCCAATGTAGAANAATGGAAGAAGCAGCTGGCAGCATATCAGGAGGAGGCGGAAATGCTACGGCAACGGGTAGCAGAGCTTGAATCTCAA
Full Trace Sequence: CCAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTCTATCAATAACAGGGAGCAGCCAATTTTTAGCACCCGGGCTCATGTGTTTCAGATCGACCCAGTCACAAAAAAGAACTGGCTTCCGGCCAGCAAACATGCGGTCACAGTATCATACTTCTACGATGCTACAAGGAATGTATACCGCATCATCAGTGTGGGGGGCACCAAGGCCATCATCAACAGTACCATAACTCCAAACATGACATTTACCAAAACCTCACAGAAGTTCGGACAATGGGCCGACAGTCGTGCCAACACTGTGTATGGATTGGGCTTCGCTTCAGAGCAGAATTTATTTCAGTTTGCAGAGAAGTTCCAGGAAGTGAGGGAAGCTGCCCGACTGGCAAGGGAGAGATCTCAGGACAAGACTGAGCTTACAAACCCTGCACTTAATATTACTTCTCAGCAGGTACTTCCTTCTCCTATTATCAGTGCCAATGGACCAGGGGATGACAAGCTGTTTCGGAGCCAGAGTGCAGAGATGGAACTTAGCACAGAAAGGGAACGTGTTAAGAAGATGCTCTCCGAAGGCTCAGTGTGTGAAGTTCAGTGGGAAGCCGAGTTCTTCAGTCTCCAGGATAATAACAACAAGTTGGTGGCAGCCCTTCGAGAAGCTAATGCCAATGTAGAANAATGGAAGAAGCAGCTGGCAGCATATCAGGAGGAGGCGGAAATGCTACGGCAACGGGTAGCAGAGCTTGAATCTCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTCTATCAATAACAGGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ828900
dbEST ID: 79646602
Trimmed Sequence: GTTGCTTTCTAGAAGTTTAGAGAGTCCCATACGCAACTCATTCAGTTGACATATTTTCACATCAAGATCTTCTCCAGCTTTGCTAATCTCTTCTCGAACTCGATCTCTTTCTGACTGGGAGTCTTTGAGGCTCTGTTCTGATCTCTCTAGTTCCTTCTCCATTTCTTGGTTTTGCGTTTCCAGCTCCTGCAGCCTCTGAAGTAGCTTGTCTCTCTCACTCTCCAGTTCCATTAGATCAGGCCTCTGTTCCCTCAACAAAAGAATTTCCTCCTCCTTAGTTTTGAGAAGGGCCTCCAAGTCTTTTAGTCTTGAGGCCAGTTCATCCCCAGGTTCTTCATTTGTCTCTTTCAGTGTCTGAGATTCAAGCTCTGCTACCCGTTGCCGTAGCATTTCCGCCTCCTCCTGATATGCTGCCAGCTGCTTCTTCCATTTTTCTACATTGGCATTAGCTTCTCGAAGGGCTGCCACCAACTTGTTGTTATTATCCTGGAGACTGAAGAACTCGGCTTCCCACTGAACTTCACACACTGAGCCTTCGGAGAGCATCTTCTTAACACGTTCCCTTTCTGTGCTAAGTTCCATCTCTGCACTCTGGCTCCGAAACAGCTTGTCATCCCCTGGTCCATTGGCACTGATTATAAGAAAAGGGAGTAACTGCTGAAGAGTAA
Full Trace Sequence: CTGCCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGCTTTCTAGAAGTTTAGAGAGTCCCATACGCAACTCATTCAGTTGACATATTTTCACATCAAGATCTTCTCCAGCTTTGCTAATCTCTTCTCGAACTCGATCTCTTTCTGACTGGGAGTCTTTGAGGCTCTGTTCTGATCTCTCTAGTTCCTTCTCCATTTCTTGGTTTTGCGTTTCCAGCTCCTGCAGCCTCTGAAGTAGCTTGTCTCTCTCACTCTCCAGTTCCATTAGATCAGGCCTCTGTTCCCTCAACAAAAGAATTTCCTCCTCCTTAGTTTTGAGAAGGGCCTCCAAGTCTTTTAGTCTTGAGGCCAGTTCATCCCCAGGTTCTTCATTTGTCTCTTTCAGTGTCTGAGATTCAAGCTCTGCTACCCGTTGCCGTAGCATTTCCGCCTCCTCCTGATATGCTGCCAGCTGCTTCTTCCATTTTTCTACATTGGCATTAGCTTCTCGAAGGGCTGCCACCAACTTGTTGTTATTATCCTGGAGACTGAAGAACTCGGCTTCCCACTGAACTTCACACACTGAGCCTTCGGAGAGCATCTTCTTAACACGTTCCCTTTCTGTGCTAAGTTCCATCTCTGCACTCTGGCTCCGAAACAGCTTGTCATCCCCTGGTCCATTGGCACTGATTATAAGAAAAGGGAGTAACTGCTGAAGAGTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGCTTTCTAGAAGTTTAGAGAG