ORFeome > hoxa13 ORF1 – XORFeome v1.0

hoxa13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxa13
Gene ID: 865329
Gene Page ID: 479979
ORF Xenbase ID: 17279433

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129574
Original XGC clone length: 888

Human orthology & disease relationships

NCBI Entrez ID: 3209
Ensembl gene IDs: ENSG00000106031
Directly associated (OMIM) disease MIM numbers: 140000,176305
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ838668
dbEST ID: 79656370
Trimmed Sequence: ATGACAGCTTCAGTGCTCCTCCATCCGCGCTGGGCCGAGCCGGTGATGTTCCTTTACGACAACAGCCTGGAGGAGATGAACAAGAATATGGATGGCTTCCCAGTGAGCAGCTTTGCAGCCAACCAGTGCAGGAATCTAATAGGGCACCACGCACCCCTGCCCCCCAGCAGCGCCTACCCCAGCAGTGAAGTGCCAGTGTCTGCCATAGCGGAGCCTTCCAAGCAGTGCAACCCCTGCTCCGCCGTGCAGAGCACCCCCAATGGCAGCCTGCCCTATGGATACTTTGGCAGCGGATATTATCCCTGCAGGATGAGCCACCACAACGGCATCAAGTCGTGCTCCCAGCCCTCTTCCTTTGCTGAAAAGTACATGGACACCTCGGGCTCCGCGGGGGAGGACTTCGCCTCCAGGCCTAAGGAATTCGCCTTTTATCAAAGTTACCCCCCTGGACCTTACCAGCCTGTGCCCAGCTACCTGGATATGCCCGTGGTTTCTACCATTGGCTCTACAGGGGAGCCCAGGCACGAGCCTTTACTGCCTATGGATGGATACCAAGCGTGGCCCATCACTAATGGCTGGAATGGGCAGGTTTATTGTGCCAAGGATCAGGCCCAGCCAACCCACCTCTGGAAATCGTCTCTGCCCGATGTCGTGCATCATTCAGACCGCAGCTCGTACAAAAGGGGCAGGGAAAAAAAAGGTTCCTTTATCCCA
Full Trace Sequence: GCTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGCTTCAGTGCTCCTCCATCCGCGCTGGGCCGAGCCGGTGATGTTCCTTTACGACAACAGCCTGGAGGAGATGAACAAGAATATGGATGGCTTCCCAGTGAGCAGCTTTGCAGCCAACCAGTGCAGGAATCTAATAGGGCACCACGCACCCCTGCCCCCCAGCAGCGCCTACCCCAGCAGTGAAGTGCCAGTGTCTGCCATAGCGGAGCCTTCCAAGCAGTGCAACCCCTGCTCCGCCGTGCAGAGCACCCCCAATGGCAGCCTGCCCTATGGATACTTTGGCAGCGGATATTATCCCTGCAGGATGAGCCACCACAACGGCATCAAGTCGTGCTCCCAGCCCTCTTCCTTTGCTGAAAAGTACATGGACACCTCGGGCTCCGCGGGGGAGGACTTCGCCTCCAGGCCTAAGGAATTCGCCTTTTATCAAAGTTACCCCCCTGGACCTTACCAGCCTGTGCCCAGCTACCTGGATATGCCCGTGGTTTCTACCATTGGCTCTACAGGGGAGCCCAGGCACGAGCCTTTACTGCCTATGGATGGATACCAAGCGTGGCCCATCACTAATGGCTGGAATGGGCAGGTTTATTGTGCCAAGGATCAGGCCCAGCCAACCCACCTCTGGAAATCGTCTCTGCCCGATGTCGTGCATCATTCAGACCGCAGCTCGTACAAAAGGGGCAGGGAAAAAAAAGGTTCCTTTATCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGCTTCAGTGCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838667
dbEST ID: 79656369
Trimmed Sequence: ACTCGTGCTTTTCAGTTTATTGACCACCTTCTTCTCCTTCACCCTCCTGTTCTGGAACCAGATAGTGACCTGCCTTTCTGAGAGGTTGGTGTTGGCAGATATCCTTCTCCTCTTATCCTTGGTGATGAATTTATTGGTAGTATATTCCCTCTCCAGCTCCTTCAGTTGTACCTTGGTATAAGGGACCCTCTTCTTCCTGCCCCTTCTGTACGAGCTGCTGTCTGACTGATGCACGACATCCGGCAGAGACGATTTCCAGAGGTGGGTTGGCTGGGCCTGATCCTTGGCACAATAAACCTGCCCATTCCAGCCATTAGTGATGGGCCACGCTTGGTATCCATCCATAGGCAGTAAAGGCTCGTGCCTGGGCTCCCCTGTAGAGCCAATGGTAGAAACCACGGGCATATCCAGGTAGCTGGGCACAGGCTGGTAAGGTCCAGGGGGGTAACTTTGATAAAAGGCGAATTCCTTAGGCCTGGAGGCGAAGTCCTCCCCCGCGGAACCCGAGGTGTCCATGTACTTTTCAGCAAAGGAAGAGGGCTGGGAGCACAACATGAATGCCTTGTGGTGGCTCCTCCTGCAGGGAAAATATCCCCTGCCAAAGTAACCATAGGGCAAGCTGCCATTGGGGGGTGCTCTGCACGGCCGAACCAAGGGTTGCCACTGCTTTGAAAAGCTCCCCCTATTGGCAAAACCC
Full Trace Sequence: AAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTCGTGCTTTTCAGTTTATTGACCACCTTCTTCTCCTTCACCCTCCTGTTCTGGAACCAGATAGTGACCTGCCTTTCTGAGAGGTTGGTGTTGGCAGATATCCTTCTCCTCTTATCCTTGGTGATGAATTTATTGGTAGTATATTCCCTCTCCAGCTCCTTCAGTTGTACCTTGGTATAAGGGACCCTCTTCTTCCTGCCCCTTCTGTACGAGCTGCTGTCTGACTGATGCACGACATCCGGCAGAGACGATTTCCAGAGGTGGGTTGGCTGGGCCTGATCCTTGGCACAATAAACCTGCCCATTCCAGCCATTAGTGATGGGCCACGCTTGGTATCCATCCATAGGCAGTAAAGGCTCGTGCCTGGGCTCCCCTGTAGAGCCAATGGTAGAAACCACGGGCATATCCAGGTAGCTGGGCACAGGCTGGTAAGGTCCAGGGGGGTAACTTTGATAAAAGGCGAATTCCTTAGGCCTGGAGGCGAAGTCCTCCCCCGCGGAACCCGAGGTGTCCATGTACTTTTCAGCAAAGGAAGAGGGCTGGGAGCACAACATGAATGCCTTGTGGTGGCTCCTCCTGCAGGGAAAATATCCCCTGCCAAAGTAACCATAGGGCAAGCTGCCATTGGGGGGTGCTCTGCACGGCCGAACCAAGGGTTGCCACTGCTTTGAAAAGCTCCCCCTATTGGCAAAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTCGTGCTTTTCAGTTTATTGAC