ORFeome > hoxa2 ORF1 – XORFeome v1.0

hoxa2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxa2
Gene ID: 6254401
Gene Page ID: 488086
ORF Xenbase ID: 17279439

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123244
Original XGC clone length: 1110

Human orthology & disease relationships

NCBI Entrez ID: 3199
Ensembl gene IDs: ENSG00000105996
Directly associated (OMIM) disease MIM numbers: 612290
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ838281
dbEST ID: 79655983
Trimmed Sequence: ATGAATTACGAATTTGAGCGAGAGATTGGTTTTATCAATAGTCAGCCGTCGCTTGCTGAGTGCCTGACATCCTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAGCTCGGCGCTTTCACACTCGACACTCATTCCTCCTCCTTTTGAGCAGACAATCCCCAGCTTGAATCCAGCCAGCCACCCTCGCCACAGCCGGCCCAAACACAGCCCAAATGGCCACGGAGACAGCCCGGTGCCAGCAGGATCCCTGCCTCCCGAGTACCCCTGGATGAAAGAGAAAAAGGCTTCCAAGAAAGCCCCTATAGTCACAGCAACAGCAGCCGCCAACGTTGCCCCGGCCACCACCGCCTGCCTCAGCCACAAAGAAATTATTGAGATCCAGGATAACAGTGGTGGGGGATCGAGACGATTAAGGACAGCTTATACCAACACTCAGCTCTTAGAACTGGAAAAAGAATTTCATTTCAACAAGTATCTGTGCAGACCGAGGAGGGTGGAAATTGCAGCCCTGTTGGATCTGACCGAAAGGCAGGTCAAAGTCTGGTTCCAGAACAGGAGAATGAAGCACAAGAGGCAAACCCAGTGCAAGGAGAACCAGAAATGGAGATGGGGGGCAATTCAAGCATCTGGACGATTGTGAGAAGGGAGAAGAAGGAAACGGAAGAAATCCCTGTTTGACCAAGCCCTTGAATAGTGGTCCTCTGGGGCTTTTGCTGGGAGAGAAAACAGCTAAAATTTTCCAACCCAAAATGCCCTTAAACCCCAACCGGCAATTCCTCACAAACCTCAAACCAAAGGGGAAAATAT
Full Trace Sequence: CGCGGGCCCATATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTACGAATTTGAGCGAGAGATTGGTTTTATCAATAGTCAGCCGTCGCTTGCTGAGTGCCTGACATCCTTTCCCCCTGTCGGTGATACATTTCAAAGTTCATCAATCAAGAGCTCGGCGCTTTCACACTCGACACTCATTCCTCCTCCTTTTGAGCAGACAATCCCCAGCTTGAATCCAGCCAGCCACCCTCGCCACAGCCGGCCCAAACACAGCCCAAATGGCCACGGAGACAGCCCGGTGCCAGCAGGATCCCTGCCTCCCGAGTACCCCTGGATGAAAGAGAAAAAGGCTTCCAAGAAAGCCCCTATAGTCACAGCAACAGCAGCCGCCAACGTTGCCCCGGCCACCACCGCCTGCCTCAGCCACAAAGAAATTATTGAGATCCAGGATAACAGTGGTGGGGGATCGAGACGATTAAGGACAGCTTATACCAACACTCAGCTCTTAGAACTGGAAAAAGAATTTCATTTCAACAAGTATCTGTGCAGACCGAGGAGGGTGGAAATTGCAGCCCTGTTGGATCTGACCGAAAGGCAGGTCAAAGTCTGGTTCCAGAACAGGAGAATGAAGCACAAGAGGCAAACCCAGTGCAAGGAGAACCAGAAATGGAGATGGGGGGCAATTCAAGCATCTGGACGATTGTGAGAAGGGAGAAGAAGGAAACGGAAGAAATCCCTGTTTGACCAAGCCCTTGAATAGTGGTCCTCTGGGGCTTTTGCTGGGAGAGAAAACAGCTAAAATTTTCCAACCCAAAATGCCCTTAAACCCCAACCGGCAATTCCTCACAAACCTCAAACCAAAGGGGAAAATAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTACGAATTTGAGCGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838280
dbEST ID: 79655982
Trimmed Sequence: GTAGTTCAAATGGTGCAAGTCTATTGTGGTAAATGTATCTGTGAAAAAATCGAAACTGTCAGCTGAAATGTCTACAGGACTGTCCAAAGAGCCAGGCAGGCTGGGGGAGACTGTGTCTGAGAGCTGAAGGCAGGAATCCGAGGAGAAGACATTGAAGTCCGAGAGTGAAGCCACATCTAAGGCCTCGGGACTATCATTGTTGAGTCCAGCTGCACAGTCCAGGGCAATTGTTGATAAGCAGTTGGGCGACTGTTGCTGGACATGTCTGAGATTTTTCTCACTGTTAGATAAAGGCGATACAGGGAAACTCTGGGAATCTCCATTGTGTGAGTTGTGAGACTGCTGCTGGGCTAAGGCATTCTGCTGGAAACTATAGCTGTCTCTCTCCAGCAAAGCCCCAGAGACACTATTCAAGGCTTGCTCAAACAGGGATTTCTCCGTCTCCTCCTCTCCCTTCTCACAATCGTCCAGATGCTTGAATTTGCCCCCATCTCCCTTCTGGTTCTCCTTGCACTGGGTTTGCCTCTTGGGCTTCATTCTCCTGTTCTTGAAACCAAACTTGGACTGCCCTTTCGGTCAAAATCCACAGGGCCTGCATTTTCCACCCCCCTCGGTCTTCACAAAAACCTTTTGAAAAAGAAATTTCTTTTTCCATTTCCTAAAAGCTGAATGGTTGGTATAAACGTGGGCCTTTATCCCTCTCGAATTCC
Full Trace Sequence: GGAGCAAAATGCTATAGACCATGTAATACGACTCACTATANGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGTTCAAATGGTGCAAGTCTATTGTGGTAAATGTATCTGTGAAAAAATCGAAACTGTCAGCTGAAATGTCTACAGGACTGTCCAAAGAGCCAGGCAGGCTGGGGGAGACTGTGTCTGAGAGCTGAAGGCAGGAATCCGAGGAGAAGACATTGAAGTCCGAGAGTGAAGCCACATCTAAGGCCTCGGGACTATCATTGTTGAGTCCAGCTGCACAGTCCAGGGCAATTGTTGATAAGCAGTTGGGCGACTGTTGCTGGACATGTCTGAGATTTTTCTCACTGTTAGATAAAGGCGATACAGGGAAACTCTGGGAATCTCCATTGTGTGAGTTGTGAGACTGCTGCTGGGCTAAGGCATTCTGCTGGAAACTATAGCTGTCTCTCTCCAGCAAAGCCCCAGAGACACTATTCAAGGCTTGCTCAAACAGGGATTTCTCCGTCTCCTCCTCTCCCTTCTCACAATCGTCCAGATGCTTGAATTTGCCCCCATCTCCCTTCTGGTTCTCCTTGCACTGGGTTTGCCTCTTGGGCTTCATTCTCCTGTTCTTGAAACCAAACTTGGACTGCCCTTTCGGTCAAAATCCACAGGGCCTGCATTTTCCACCCCCCTCGGTCTTCACAAAAACCTTTTGAAAAAGAAATTTCTTTTTCCATTTCCTAAAAGCTGAATGGTTGGTATAAACGTGGGCCTTTATCCCTCTCGAATTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGTTCAAATGGTGCAAGTC