ORFeome > hoxa9 ORF1 – XORFeome v1.0

hoxa9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxa9
Gene ID: 864813
Gene Page ID: 481972
ORF Xenbase ID: 17279451

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130086
Original XGC clone length: 786

Human orthology & disease relationships

NCBI Entrez ID: 3205
Ensembl gene IDs: ENSG00000078399
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 106210,120200,120430,129750,136520,148190,165550,604229

Library Location

Plate ID: GDExl11084
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ837629
dbEST ID: 79655331
Trimmed Sequence: ATGTCGACTTCTGGGACCCTCAGCAATTATTATGTGGACTCTTTTCTAATTCACGAGGGGGACGATCTGGTGCAGCCAAGGTTTGCCCCTGGATCCCTGGCTCAGCCAGCAAGGCAAGCAGCATCGGCCGAGCACCCTGAGTTCACCCCGTGCAGCTTTCAATCCAAATCGTCAGTGTTCAGCAGCCCTTGGAACCCAGTGCACCCCCAAACTGCTAACAATGTGTCCAGTGTGTACCACCCCTATGTGCACCATCAGGCTTCCATGTCAGCTTCTGACTGCAGGTACATGCGCTCCTGGCTGGACCCCATGGCTACTGGATCCTTGCCTTTCCCTGCCTTCCCTTCCAGCAGGAGCTATGGCATTAAACCTGAACCGGTGGCTACAAGAAGGGGCGACTGCTCCACTTACGACTCTCGCTCTCTGCCTGTGTCGGACTATGGCTGCGACTCCCCAGTTGACAGGGACAAGCCACCCGGCGACCCCCCATTTGCTGTCACCAATGAAGAGAATCTCAGCAATGGAGACAAAGCGCCAATTGATCCAAACAACCCGGCTGCTAACTGGTTGCACGCGAGATCCACCAGGAAAAAACGCTGTCCCTACACCAAGCACCAAACCCTGGAGCTGGAGAAGGAGTTTTTATTCAATATGTATCTGACTAGGGACAGGAGGTACGAGGTCGCCCGACTGTTTGAACCCCCAGAACCACCAGTGAAAAATCTGGTTCAAAAAAGGAAGGAATGAAAAG
Full Trace Sequence: CGAGGGCCATATAANTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGACTTCTGGGACCCTCAGCAATTATTATGTGGACTCTTTTCTAATTCACGAGGGGGACGATCTGGTGCAGCCAAGGTTTGCCCCTGGATCCCTGGCTCAGCCAGCAAGGCAAGCAGCATCGGCCGAGCACCCTGAGTTCACCCCGTGCAGCTTTCAATCCAAATCGTCAGTGTTCAGCAGCCCTTGGAACCCAGTGCACCCCCAAACTGCTAACAATGTGTCCAGTGTGTACCACCCCTATGTGCACCATCAGGCTTCCATGTCAGCTTCTGACTGCAGGTACATGCGCTCCTGGCTGGACCCCATGGCTACTGGATCCTTGCCTTTCCCTGCCTTCCCTTCCAGCAGGAGCTATGGCATTAAACCTGAACCGGTGGCTACAAGAAGGGGCGACTGCTCCACTTACGACTCTCGCTCTCTGCCTGTGTCGGACTATGGCTGCGACTCCCCAGTTGACAGGGACAAGCCACCCGGCGACCCCCCATTTGCTGTCACCAATGAAGAGAATCTCAGCAATGGAGACAAAGCGCCAATTGATCCAAACAACCCGGCTGCTAACTGGTTGCACGCGAGATCCACCAGGAAAAAACGCTGTCCCTACACCAAGCACCAAACCCTGGAGCTGGAGAAGGAGTTTTTATTCAATATGTATCTGACTAGGGACAGGAGGTACGAGGTCGCCCGACTGTTTGAACCCCCAGAACCACCAGTGAAAAATCTGGTTCAAAAAAGGAAGGAATGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGACTTCTGGGACCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837628
dbEST ID: 79655330
Trimmed Sequence: TTCGTCTTTTGAGCGATCCTTGTTGATTTTTTTCATTTTCATCCTCCTATTTTGGAACCAGATTTTCACTTGTCGCTCTGTGAGGTTCAACAGTCTGGCGACCTCGTACCTCCTGTCCCTAGTCAGATACATATTGAATAAAAACTCCTTCTCCAGCTCCAGGGTTTGGTGCTTGGTGTAGGGACAGCGTTTTTTCCTGGTGGATCTCGCGTGCAACCAGTTAGCAGCCGGGTTGTTTGGATCAATTGGCGCTTTGTCTCCATTGCTGAGATTCTCTTCATTGGTGACAGCAAATGGGGGGTCGCCGGGTGGCTTGTCCCTGTCAACTGGGGAGTCGCAGCCATAGTCCGACACAGGCAGAGAGCGAGAGTCGTAAGTGGAGCAGTCGCCCCTTCTTGTAGCCACCGGTTCAGGTTTAATGCCATAGCTCCTGCTGGAAGGGAAGGCAGGGAAAGGCAAGGATCCAGTAGCCATGGGGTCCAGCCAGGAGCGCATGTACCTGCAGTCAGAAGCTGACATGGGAACCTGATGGTGCAGATAGGGGTGGTACACACTGGACACCTTTGTTACCGTTTGGGGGTGCCCTGGGTTCCCAGGGCTGCTGAGCACTGACCAATTTGGAATGAAAAGGTGCACGGGGGTGAACTCCAGGGTTGCTCGGGCCCAAATGCTGCTTGCCCTTTCTGGCCTGAACCCAGGGAATCCCAGGGACCAAGACCTTTTGCCTTCCCACCAAAAATGGTTCCCCCCCTCTCGTTGAAA
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCGTCTTTTGAGCGATCCTTGTTGATTTTTTTCATTTTCATCCTCCTATTTTGGAACCAGATTTTCACTTGTCGCTCTGTGAGGTTCAACAGTCTGGCGACCTCGTACCTCCTGTCCCTAGTCAGATACATATTGAATAAAAACTCCTTCTCCAGCTCCAGGGTTTGGTGCTTGGTGTAGGGACAGCGTTTTTTCCTGGTGGATCTCGCGTGCAACCAGTTAGCAGCCGGGTTGTTTGGATCAATTGGCGCTTTGTCTCCATTGCTGAGATTCTCTTCATTGGTGACAGCAAATGGGGGGTCGCCGGGTGGCTTGTCCCTGTCAACTGGGGAGTCGCAGCCATAGTCCGACACAGGCAGAGAGCGAGAGTCGTAAGTGGAGCAGTCGCCCCTTCTTGTAGCCACCGGTTCAGGTTTAATGCCATAGCTCCTGCTGGAAGGGAAGGCAGGGAAAGGCAAGGATCCAGTAGCCATGGGGTCCAGCCAGGAGCGCATGTACCTGCAGTCAGAAGCTGACATGGGAACCTGATGGTGCAGATAGGGGTGGTACACACTGGACACCTTTGTTACCGTTTGGGGGTGCCCTGGGTTCCCAGGGCTGCTGAGCACTGACCAATTTGGAATGAAAAGGTGCACGGGGGTGAACTCCAGGGTTGCTCGGGCCCAAATGCTGCTTGCCCTTTCTGGCCTGAACCCAGGGAATCCCAGGGACCAAGACCTTTTGCCTTCCCACCAAAAATGGTTCCCCCCCTCTCGTTGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCGTCTTTTGAGCGATCCTT