ORFeome > hoxb4 ORF1 – XORFeome v1.0

hoxb4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxb4
Gene ID: 6078784
Gene Page ID: 1033881
ORF Xenbase ID: 17279457

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106429
Original XGC clone length: 699

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ837942
dbEST ID: 79655644
Trimmed Sequence: ATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAAAAAAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAAAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAAAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAAACACAAGCTCCCCATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAATTTGCGGGGGGGTCCCGAATCCAAACAAAGGGAAACAAGGGCTGCCAATGGCCAATTTTTTGGTAAAAGTTGGGCATTATAAAAAAAGCAATGGCTAAACCAATTTTTTTGCAACGAAAAGGGTTATATATACATTCAAAAAAAAAAATAATTTAATTTGCCCTTCCCGCCCTAAA
Full Trace Sequence: TCGTGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGACCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCATAGTGATTACTCTCCGGGGTATTACGGCAGCCAAAAAAGGGAGAGCAGTTTTCAGCATGGGGCACCCTACCCTCGATCCGTGTCCAGCAATAGCAGCAGCAGCGCGTCCTACTCCTCCTGCCAAGGATCTGTGCGTCAAAGCGCAAGGCTGCCTCACTCATCTGGACTTGTCCCAGGCGAGAAAGCGCACTTGGAGCCCCACATGCCCACCAGTTCGCCTCCATCCTGCAGCCTCAAGTCCTCAAAGCACAAGCACCCCGACTCCCCGGAGCAGGACCCCGTGGTGTACCCCTGGATGAAAAAGGCGCACATCTCCAAGGCCACTTCCACTTACTCTGATGGAGAAGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTCGAACTGGAGAAGGAGTTTCACTACAATCGCTACCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTCTCTGAGCGACAAATTAAGATCTGGTTCCAGAACAGGAGGATGAAGTGGAAGAAAAACACAAGCTCCCCATACCAAGATCAAGTCTAACCCTTCTGTGAACCTCCAATTTGCGGGGGGGTCCCGAATCCAAACAAAGGGAAACAAGGGCTGCCAATGGCCAATTTTTTGGTAAAAGTTGGGCATTATAAAAAAAGCAATGGCTAAACCAATTTTTTTGCAACGAAAAGGGTTATATATACATTCAAAAAAAAAAATAATTTAATTTGCCCTTCCCGCCCTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAATGAGTTCGTTTTTGATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837941
dbEST ID: 79655643
Trimmed Sequence: TTGGCAGACATGGTTCCCTTTGTTCTGATTCGGGGACCCCCCTGCAATTTGGAGGTTCACAGAAGGGTTAGACTTGATCTTGGTATTGGGGAGCTTGTGGTCTTTCTTCCACTTCATCCTCCTGTTCTGGAACCAGATCTTAATTTGTCGCTCAGAGAGGCGCAAAGTGTGCGCAATTTCCACCCTGCGCCTGCGGGTCAGGTAGCGATTGTAGTGAAACTCCTTCTCCAGTTCGAGCACTTGCTGCCTGGTGTAAGCTGTACGGGATCTCTTGGCTTCTCCATCAGAGTAAGTGGAAGTGGCCTTGGAGATGTGCGCCTTCTTCATCCAGGGGTACACCACGGGGTCCTGCTCCGGGGAGTCGGGGTGCTTGTGCTCTGAGGACTTGAGGCTGCAGGATGGAGGCGAACTGGTGGGCATGTGGGGCTCCAAGTGCGCTTTCTCGCCTGGGACAAGTCCAGATGAGTGAGGCAGCCTTGCGCTTTCACGCACAGATCCTTGGCAGGAGGAGTAGGACGCGCTGCTGCTGCTATTGCTGGACACGATCGAGGGTAGGATGCCCCATGCTTGAAACTGGCTCTCCCCCTTCTGCTGCCGTATACCCGGGAAAATAATCACTATGAGAATACGCCTCAAAGGGCGAAACGTGGGGTCCACATAGGTGGAACTGAAACAAAACAAAACTCATTCAAATGGTGCCAACTTTTTTTTGTGGGGGTTTGGGCAATGGAAAAAAAAACGGTGGCTCNNCTCAATTTTTTAGTACAA
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGCAGACATGGTTCCCTTTGTTCTGATTCGGGGACCCCCCTGCAATTTGGAGGTTCACAGAAGGGTTAGACTTGATCTTGGTATTGGGGAGCTTGTGGTCTTTCTTCCACTTCATCCTCCTGTTCTGGAACCAGATCTTAATTTGTCGCTCAGAGAGGCGCAAAGTGTGCGCAATTTCCACCCTGCGCCTGCGGGTCAGGTAGCGATTGTAGTGAAACTCCTTCTCCAGTTCGAGCACTTGCTGCCTGGTGTAAGCTGTACGGGATCTCTTGGCTTCTCCATCAGAGTAAGTGGAAGTGGCCTTGGAGATGTGCGCCTTCTTCATCCAGGGGTACACCACGGGGTCCTGCTCCGGGGAGTCGGGGTGCTTGTGCTCTGAGGACTTGAGGCTGCAGGATGGAGGCGAACTGGTGGGCATGTGGGGCTCCAAGTGCGCTTTCTCGCCTGGGACAAGTCCAGATGAGTGAGGCAGCCTTGCGCTTTCACGCACAGATCCTTGGCAGGAGGAGTAGGACGCGCTGCTGCTGCTATTGCTGGACACGATCGAGGGTAGGATGCCCCATGCTTGAAACTGGCTCTCCCCCTTCTGCTGCCGTATACCCGGGAAAATAATCACTATGAGAATACGCCTCAAAGGGCGAAACGTGGGGTCCACATAGGTGGAACTGAAACAAAACAAAACTCATTCAAATGGTGCCAACTTTTTTTTGTGGGGGTTTGGGCAATGGAAAAAAAAACGGTGGCTCNNCTCAATTTTTTAGTACAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGCAGACATGGTTCCCTT