ORFeome > hoxb6 ORF1 – XORFeome v1.0

hoxb6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxb6
Gene ID: 1006009
Gene Page ID: 1006004
ORF Xenbase ID: 17279463

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123270
Original XGC clone length: 672

Human orthology & disease relationships

NCBI Entrez ID: 3216
Ensembl gene IDs: ENSG00000108511
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 270200,604232,607765,608643,609924

Library Location

Plate ID: GDExl11092
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ838789
dbEST ID: 79656491
Trimmed Sequence: ATGAGTTCCATTTTGTCAACTCCACTTTCCCGGTAACTCTGCCCGGTGGGCAGGAACCCTTCCTGGGACAGATCCCGTTATATTCCTCAGGATATGCGGATCCTTTAAGGCATTATTCTGCCAGCTACGGGGCCACAGGGGTCCAGGACAAGAGCTACGCGCCCGGCCCGTATTTCCAGCAGGCGAGTGGAGCTTACAGTCGGACGGCGGCGTGCGATTATGGCGCACCGGGATTTTACAGGGACAAGGAGGTTTCGTGCGCTCTTTCCTCGCTGGAGGAGCAGTCGCAGTACAACCAGGAACAGCGCAAAGCGGACTGTGCGCACAACAAACTGGTGTATGAGGAGCAAGACGAGGCAAAGTGCGCCACTCCTGTCTACCCCTGGATGCAAAGGATGAACTCGTGCAACAGTTCTATGTTCGGGCCCAGTGGAATGAAAGGGAAACAGACCTACACCAGGTACCAGACTCTGGAGCTGGAAAAAGAATTTCACTTCAACCTCTACTTGACTCCTAGGCGCAGGATGAAAATTGCACATTCTCTTTGCCTCACCGAGCGCCAAATCAAAATCTGGTTTCCTAACAGAAAGATTAATTGTAAAATTGAGAAATAACTACGTCAATTTCTCGGTACAAACCGCCGGTGAAGAAGAAGAAAAGCCGACGGATGTGCAACCTTTCTTGAACAATTTTTCTATAATATAAAAACATTTCATAATTCTTTTTTTTTCCTGCACAAAAGAGGCATGATTAGTTCTAAGATGAAAATTCCTTTTTTATTAGGATCCGGCGCTGTGATCTCCCCCCTAGTGGGTGAAGTAA
Full Trace Sequence: CGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTCCATTTTGTCAACTCCACTTTCCCGGTAACTCTGCCCGGTGGGCAGGAACCCTTCCTGGGACAGATCCCGTTATATTCCTCAGGATATGCGGATCCTTTAAGGCATTATTCTGCCAGCTACGGGGCCACAGGGGTCCAGGACAAGAGCTACGCGCCCGGCCCGTATTTCCAGCAGGCGAGTGGAGCTTACAGTCGGACGGCGGCGTGCGATTATGGCGCACCGGGATTTTACAGGGACAAGGAGGTTTCGTGCGCTCTTTCCTCGCTGGAGGAGCAGTCGCAGTACAACCAGGAACAGCGCAAAGCGGACTGTGCGCACAACAAACTGGTGTATGAGGAGCAAGACGAGGCAAAGTGCGCCACTCCTGTCTACCCCTGGATGCAAAGGATGAACTCGTGCAACAGTTCTATGTTCGGGCCCAGTGGAATGAAAGGGAAACAGACCTACACCAGGTACCAGACTCTGGAGCTGGAAAAAGAATTTCACTTCAACCTCTACTTGACTCCTAGGCGCAGGATGAAAATTGCACATTCTCTTTGCCTCACCGAGCGCCAAATCAAAATCTGGTTTCCTAACAGAAAGATTAATTGTAAAATTGAGAAATAACTACGTCAATTTCTCGGTACAAACCGCCGGTGAAGAAGAAGAAAAGCCGACGGATGTGCAACCTTTCTTGAACAATTTTTCTATAATATAAAAACATTTCATAATTCTTTTTTTTTCCTGCACAAAAGAGGCATGATTAGTTCTAAGATGAAAATTCCTTTTTTATTAGGATCCGGCGCTGTGATCTCCCCCCTAGTGGGTGAAGTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTCCTATTTTGTCAACTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838788
dbEST ID: 79656490
Trimmed Sequence: CTCGGTCGGCTTCTCCTCGTCCTCCCCCGCGCTCTGTACCGAGGAATTGAGTAGTTTACTCTCCTTTTTCCACTTCATCCTCCTGTTCTGGAACCAGATCTTGATTTGGCGCTCGGTGAGGCAAAGAGAATGCGCAATTTCGATCCTGCGCCTCCGGGTCAAGTAGCGGTTGAAGTGAAATTCCTTTTCCAGCTCCAGAGTCTGGTACCTGGTGTAGGTCTGTCTCCCTCTCCTTCCACTGGGCCCGAACATAGAACTGTTGCACGAGTTCATCCTTTGCATCCAGGGGTAGACAGGAGTGGCGCACTTTGCCTCGTCTTGCTCCTCATACACCAGTTTGTTGTGCGCACAGTCCGCTTTGCGCTGCTCCTGGTTGTACTGCGACTGCTCCTCCAGCGAGGAAAGAGCGCACGAGACCTCCTTGTCCCTGTAAGATCCCGCTGCGCCATAATCGCACGCCGCCGTCCGACTGTAAGCTCCACTCGCCTGCTGGAAATACGGGCCGGGCGCGTAGCTCTTGTCCTGGACCCCTGTGGCCCCGTAACTGGCAGAATAATGCCTTAAAGGAACCGCATATCCTGAAGAATATAACGGAATCTGTTCCAAGAAGGTTTCCTGCCCCCCGGGCAGAATTACCCGGAAAAGTGGAATTTACAAAATGAAACTCATGGGGGCCCCCTTTTGTTTACCAAATTTTGGCTTAAAAAAAAAGGAAATTGCCTCATGCAATTTAGTTGGCCACCCAAAAAAAAAAAAAAAAGAGAAAAAAAAAAAA
Full Trace Sequence: AAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGGTCGGCTTCTCCTCGTCCTCCCCCGCGCTCTGTACCGAGGAATTGAGTAGTTTACTCTCCTTTTTCCACTTCATCCTCCTGTTCTGGAACCAGATCTTGATTTGGCGCTCGGTGAGGCAAAGAGAATGCGCAATTTCGATCCTGCGCCTCCGGGTCAAGTAGCGGTTGAAGTGAAATTCCTTTTCCAGCTCCAGAGTCTGGTACCTGGTGTAGGTCTGTCTCCCTCTCCTTCCACTGGGCCCGAACATAGAACTGTTGCACGAGTTCATCCTTTGCATCCAGGGGTAGACAGGAGTGGCGCACTTTGCCTCGTCTTGCTCCTCATACACCAGTTTGTTGTGCGCACAGTCCGCTTTGCGCTGCTCCTGGTTGTACTGCGACTGCTCCTCCAGCGAGGAAAGAGCGCACGAGACCTCCTTGTCCCTGTAAGATCCCGCTGCGCCATAATCGCACGCCGCCGTCCGACTGTAAGCTCCACTCGCCTGCTGGAAATACGGGCCGGGCGCGTAGCTCTTGTCCTGGACCCCTGTGGCCCCGTAACTGGCAGAATAATGCCTTAAAGGAACCGCATATCCTGAAGAATATAACGGAATCTGTTCCAAGAAGGTTTCCTGCCCCCCGGGCAGAATTACCCGGAAAAGTGGAATTTACAAAATGAAACTCATGGGGGCCCCCTTTTGTTTACCAAATTTTGGCTTAAAAAAAAAGGAAATTGCCTCATGCAATTTAGTTGGCCACCCAAAAAAAAAAAAAAAAGAGAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGGTCGGCTTCTCCT