ORFeome > hoxc5 ORF1 – XORFeome v1.0

hoxc5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxc5
Gene ID: 865541
Gene Page ID: 485671
ORF Xenbase ID: 17279487

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124880
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ838251
dbEST ID: 79655953
Trimmed Sequence: ATGAGTTCGTACGTAGCCAATTCATTCTATAAGCAAAGTCAAAACGTTCCAGCCTATTCCATGCAAAGTTATGGGAATTATGGATCTGTATCCGAGGTCCCTTCATCCAGGTACTGCTACAGTGGGTTGGATCTGAGCATTACATTCCCTTCTCCTGGTTCTTCTAACTCTCTGAGCGCTTTGGACATGCCTTCAAACCCAACTGCTAACCCTGAGCGGCCCTCCTGCACTGTTATGGGTTCTTCTGGGCACACTGTGGGAAGAGGAGAGCAGAGTGCCCTCAACTCTGGGATTTACAATCAGAAAGCTGCGACTACAGCGCTGGAGGAGAGATCTAAAGGGATGGAGAGCATCAAAACTGAGCCGGCACAGAGCACTCCACAAGGTGGGCAACCACAGCAGCAACAGCAGCAGCAGCAGCCACCACAAATATATCCTTGGATGACCAAACTGCACATGAGCCATGAAACGGACGGGAAGCGTTCCCGGACAAGTTACACTCGATACCAGACCCTGGAGCTGGAGAAGGAATTCCACTTTAATAGATACCTGACTCGCCGAAGGCGCATAGAGATCGCCAACAACCTCTGTCTAAACGAGAGGCAGATCAAAATTTGGTTCCAAAACCGACGGATGAAATGGGAGAAAGAACACAAAATCAGGAGCAAAGACTCCATGTT
Full Trace Sequence: TCGGGGGCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTCGTACGTAGCCAATTCATTCTATAAGCAAAGTCAAAACGTTCCAGCCTATTCCATGCAAAGTTATGGGAATTATGGATCTGTATCCGAGGTCCCTTCATCCAGGTACTGCTACAGTGGGTTGGATCTGAGCATTACATTCCCTTCTCCTGGTTCTTCTAACTCTCTGAGCGCTTTGGACATGCCTTCAAACCCAACTGCTAACCCTGAGCGGCCCTCCTGCACTGTTATGGGTTCTTCTGGGCACACTGTGGGAAGAGGAGAGCAGAGTGCCCTCAACTCTGGGATTTACAATCAGAAAGCTGCGACTACAGCGCTGGAGGAGAGATCTAAAGGGATGGAGAGCATCAAAACTGAGCCGGCACAGAGCACTCCACAAGGTGGGCAACCACAGCAGCAACAGCAGCAGCAGCAGCCACCACAAATATATCCTTGGATGACCAAACTGCACATGAGCCATGAAACGGACGGGAAGCGTTCCCGGACAAGTTACACTCGATACCAGACCCTGGAGCTGGAGAAGGAATTCCACTTTAATAGATACCTGACTCGCCGAAGGCGCATAGAGATCGCCAACAACCTCTGTCTAAACGAGAGGCAGATCAAAATTTGGTTCCAAAACCGACGGATGAAATGGGAGAAAGAACACAAAATCAGGAGCAAAGACTCCATGTTGCCAACTTTCTTGTACAAAGTTGGCATAAAAGAAAACATGCTTTAACAATTTGTTTCCAACGAAAAGGCCCTATCAAGCCCAAATAAAACCATATTTTTCCCCCCCGCCTGAAAACCCCCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTCGTACGTAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838250
dbEST ID: 79655952
Trimmed Sequence: CATGGAGTCTTTGCTCTTGACTTTTGTGTCTTTCTTCCATTTCATCCGTCGGTTCTGGAACCAAATTTTGATCTGCCTCTCGTTTAGACAGAGGTTGTTGGCGATCTCTATGCGCCTTCGGCGAGTCAGGTATCTATTAAAGTGGAATTCCTTCTCCAGCTCCAGGGTCTGGTATCGAGTGTAACTTGTCCGGGAACGCTTCCCGTCCGTTTCATGGCTCATGTGCAGTTTGGTCATCCAAGGATATATTTGTGGTGGCTGCTGCTGCTGCTGTTGCTGCTGTGGTTGCCCACCTTGTGGAGTGCTCTGTGCCGGCTCAGTTTTGATGCTCTCCATCCCTTTAGATCTCTCCTCCAGCGCTGTAGTCGCAGCTTTCTGATTGTAAATCCCAGAGTTGAGGGCACTCTGCTCTCCTCTTCTCACACTGTGCCCGGAAGAACCCATAACAGTGCAGGAGGGCCGCGTCAGGGTTAGCAGATGGGTTTTGAAGTCTGTCCAAACCGCTCACACAATTAAAAGAAACGGGAAGAGGAAGTGTGGTGCGTCAAATCACCCAACTGTAACAATTGCCTCCATGAAGGGAACCTCGGATACGAAGCAAAGGTTCAAATAACTTTTCATGGAATAAGCTGGGAAGATTTGGACTTACCTAAAAATTGAAATAAAAATGCAACGAACGCCATAATGCCGAACGTGGTTGGGCAAAGTTAGGGAATGAAGAAAAGGGAGGTGATTAATACAATTTGTTGGCGGCGAACGAGNNNNNNCGTAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: AAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGGAGTCTTTGCTCTTGACTTTTGTGTCTTTCTTCCATTTCATCCGTCGGTTCTGGAACCAAATTTTGATCTGCCTCTCGTTTAGACAGAGGTTGTTGGCGATCTCTATGCGCCTTCGGCGAGTCAGGTATCTATTAAAGTGGAATTCCTTCTCCAGCTCCAGGGTCTGGTATCGAGTGTAACTTGTCCGGGAACGCTTCCCGTCCGTTTCATGGCTCATGTGCAGTTTGGTCATCCAAGGATATATTTGTGGTGGCTGCTGCTGCTGCTGTTGCTGCTGTGGTTGCCCACCTTGTGGAGTGCTCTGTGCCGGCTCAGTTTTGATGCTCTCCATCCCTTTAGATCTCTCCTCCAGCGCTGTAGTCGCAGCTTTCTGATTGTAAATCCCAGAGTTGAGGGCACTCTGCTCTCCTCTTCTCACACTGTGCCCGGAAGAACCCATAACAGTGCAGGAGGGCCGCGTCAGGGTTAGCAGATGGGTTTTGAAGTCTGTCCAAACCGCTCACACAATTAAAAGAAACGGGAAGAGGAAGTGTGGTGCGTCAAATCACCCAACTGTAACAATTGCCTCCATGAAGGGAACCTCGGATACGAAGCAAAGGTTCAAATAACTTTTCATGGAATAAGCTGGGAAGATTTGGACTTACCTAAAAATTGAAATAAAAATGCAACGAACGCCATAATGCCGAACGTGGTTGGGCAAAGTTAGGGAATGAAGAAAAGGGAGGTGATTAATACAATTTGTTGGCGGCGAACGAGNNNNNNCGTAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGGAGTCTTTGCTCTTGACTT