ORFeome > hoxc8 ORF1 – XORFeome v1.0

hoxc8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxc8
Gene ID: 865431
Gene Page ID: 480998
ORF Xenbase ID: 17279505

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124877
Original XGC clone length: 735

Human orthology & disease relationships

NCBI Entrez ID: 3224
Ensembl gene IDs: ENSG00000037965
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 192950

Library Location

Plate ID: GDExl11088
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ838214
dbEST ID: 79655916
Trimmed Sequence: ATGAGCTCCTATTTTGTAAACCCTCTCTTCTCCAAGTACAAAGGCAGCGAGTCCTTGGAACCAACTTACTACGACTGCCGATTCCCACAAAGTGTCAGCAGGAGCCACGCTTTGGTGTACGGTCCGAGTGCCACGGCTCCAGGCTTCCAGCACCCCTCTCACCATGTCCAGGAGTTCTTCCATCATGGAACCTCCAGCATCACCAATTCTGGATACCAACAAAATCCCTGCGCCCTGACCTGCCACGGAGACGCATCCAAATTCTATGGCTACGAGGCGCTGCCCAGGCAATCTCTTTATGGTGCCCAGCAAGAGGCAAGCGTGGTGCAGTACCCCGACTGTAAATCGTCCTCCAACACTAACACTAGCGAAGGACAAGGCCATTTAAATCAAAACTCGTCTCCCAGTCTCATGTTCCCATGGATGAGACCTCACGCCCCCGGAAGGAGAAGTGGAAGACAGACGTACAGCCGGTACCAAACACTGGAGCTGGAGAAGGAATTCCTCTTCAACCCTTACTTGACTCGCAAGCGCCGCATCGAGGTCTCCCATGCCCTGGGACTGACTGAGAGGCAAGTCAAGATATGGTTTCAAAACAGAAGGATGAAATGGAAAAAAGAGAATAACAAGGATAAGCTACCGGGGGCCCGAGAAGAAGAAAAAACAGAGGAAGGAAAAGAAGGGAAGAAGGAAAAAGAGGAAAAAGGAAAAGGAAACAAAGGAAAAGCAAGGAATTGCCCAATTTCCTTGTACAAAATTGGGCATTAAAAAAAAAGCATTTTGCTTTACCAATTTTTTTTGCCAACCAAAAAAGG
Full Trace Sequence: CGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTCCTATTTTGTAAACCCTCTCTTCTCCAAGTACAAAGGCAGCGAGTCCTTGGAACCAACTTACTACGACTGCCGATTCCCACAAAGTGTCAGCAGGAGCCACGCTTTGGTGTACGGTCCGAGTGCCACGGCTCCAGGCTTCCAGCACCCCTCTCACCATGTCCAGGAGTTCTTCCATCATGGAACCTCCAGCATCACCAATTCTGGATACCAACAAAATCCCTGCGCCCTGACCTGCCACGGAGACGCATCCAAATTCTATGGCTACGAGGCGCTGCCCAGGCAATCTCTTTATGGTGCCCAGCAAGAGGCAAGCGTGGTGCAGTACCCCGACTGTAAATCGTCCTCCAACACTAACACTAGCGAAGGACAAGGCCATTTAAATCAAAACTCGTCTCCCAGTCTCATGTTCCCATGGATGAGACCTCACGCCCCCGGAAGGAGAAGTGGAAGACAGACGTACAGCCGGTACCAAACACTGGAGCTGGAGAAGGAATTCCTCTTCAACCCTTACTTGACTCGCAAGCGCCGCATCGAGGTCTCCCATGCCCTGGGACTGACTGAGAGGCAAGTCAAGATATGGTTTCAAAACAGAAGGATGAAATGGAAAAAAGAGAATAACAAGGATAAGCTACCGGGGGCCCGAGAAGAAGAAAAAACAGAGGAAGGAAAAGAAGGGAAGAAGGAAAAAGAGGAAAAAGGAAAAGGAAACAAAGGAAAAGCAAGGAATTGCCCAATTTCCTTGTACAAAATTGGGCATTAAAAAAAAAGCATTTTGCTTTACCAATTTTTTTTGCCAACCAAAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTCCTATTTTGTAAACCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838213
dbEST ID: 79655915
Trimmed Sequence: TTCCTTGCTCTCCTTAGTCTCCTCTTCCTCTTTCTCTTCTTCCTCGTTCCCTTCCTCTCCTTCCTCTGTTTTTTCTTCTTCTCGGGCCCCCGGTAGCTTATCCTTGTTATTCTCTTTTTTCCATTTCATCCTTCTGTTTTGAAACCATATCTTGACTTGCCTCTCAGTCAGTCCCAGGGCATGGGAGACCTCGATGCGGCGCTTGCGAGTCAAGTAAGGGTTGAAGAGGAATTCCTTCTCCAGCTCCAGTGTTTGGTACCGGCTGTACGTCTGTCTTCCACTTCTCCTTCCGGGGGCGTGAGGTCTCATCCATGGGAACATGAGACTGGGAGACGAGTTTTGATTTAAATGGCCTTGTCCTTCGCTAGTGTTAGTGTTGGAGGACGATTTACAGTCGGGGTACTGCACCACGCTTGCCTCTTGCTGGGCACCATAAAGAGATTGCCTGGGCAGCGCCTCGTAGCCATAGAATTTGTATGCGTCTCCGTGGCAGGTCAGGGGCGCAGGGATTTTGTTGGTATCCAGAAATGTTGATGCTGCAAGTTTCATCGATGAAGAACTCATGAAACATGTGAAAAGGGTGCTGGAAGCCTGGAAGCGGTGACACTCAGAACAAAACACAAAGAATGGGCTCCGTCCGGCCCATAGGTGGGAATCGAGCAGGCGAAGTAAAGTTGGTTCCCAACGCCCTCACTTCCCGTTTGTTCTTTGGATTAAAAATAAGGGGGAAGAAAAAAGAGGGAAATCTCAATTGGGGGCCAGGCCTTGTTGTG
Full Trace Sequence: GGGAAAAAGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTTGCTCTCCTTAGTCTCCTCTTCCTCTTTCTCTTCTTCCTCGTTCCCTTCCTCTCCTTCCTCTGTTTTTTCTTCTTCTCGGGCCCCCGGTAGCTTATCCTTGTTATTCTCTTTTTTCCATTTCATCCTTCTGTTTTGAAACCATATCTTGACTTGCCTCTCAGTCAGTCCCAGGGCATGGGAGACCTCGATGCGGCGCTTGCGAGTCAAGTAAGGGTTGAAGAGGAATTCCTTCTCCAGCTCCAGTGTTTGGTACCGGCTGTACGTCTGTCTTCCACTTCTCCTTCCGGGGGCGTGAGGTCTCATCCATGGGAACATGAGACTGGGAGACGAGTTTTGATTTAAATGGCCTTGTCCTTCGCTAGTGTTAGTGTTGGAGGACGATTTACAGTCGGGGTACTGCACCACGCTTGCCTCTTGCTGGGCACCATAAAGAGATTGCCTGGGCAGCGCCTCGTAGCCATAGAATTTGTATGCGTCTCCGTGGCAGGTCAGGGGCGCAGGGATTTTGTTGGTATCCAGAAATGTTGATGCTGCAAGTTTCATCGATGAAGAACTCATGAAACATGTGAAAAGGGTGCTGGAAGCCTGGAAGCGGTGACACTCAGAACAAAACACAAAGAATGGGCTCCGTCCGGCCCATAGGTGGGAATCGAGCAGGCGAAGTAAAGTTGGTTCCCAACGCCCTCACTTCCCGTTTGTTCTTTGGATTAAAAATAAGGGGGAAGAAAAAAGAGGGAAATCTCAATTGGGGGCCAGGCCTTGTTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTGCTCTCCTTAGTC