ORFeome > hoxc9 ORF1 – XORFeome v1.0

hoxc9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxc9
Gene ID: 6466551
Gene Page ID: 482329
ORF Xenbase ID: 17279511

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106421
Original XGC clone length: 699

Human orthology & disease relationships

NCBI Entrez ID: 3225
Ensembl gene IDs: ENSG00000180806
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 192950

Library Location

Plate ID: GDExl11087
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ838017
dbEST ID: 79655719
Trimmed Sequence: ATGGCCATTTCTGGGCCTCTCACCAATTACTTTGTACAGTCAATTATCAGCCCCGACACTGACGAGACTCCAGCAGCCAAATTCTCTGCGCAATTCCCCAACCCACGGGCCCCTGCGCAATCTGAACCCCTGGACTTTCCCTCCTGCAGTTTCAGCGCCTCCTGGAACCCCCTGACCCCGCACCCTCCAGTCTATCAGCCCTATATCCAACAGCAGCAGCAGCAGGAGGAGGGCGCCCCCAGTGCCGAGGGCAGGTACTTACGGGCTTGGCTGGACAATGGACCGAGTCTCAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGACAAACTGGGACCCCAACATTACACTGTGGCCTCGCCCGGCGGCGCTGCTGCAAATACTGAACGTTCCACTCACAGCGGCAACTTCCCCGACACTAAAGGGACTGAAGGAACCGCCGGGGACACTGACCGGACTCATCAAAACAACCCCTCAGCCAACTGGTTACACGCTCGCTCCTCCAGAAAGAAGAGGTGCCCCTACTCCAAATACCAGACCCTGGAGCTGGAGAAAGAATTCCTGTTTAACATGTACCTGACCAGGGACAGGAGGCACGAGGTCGCCAGGCTGTTGAACCTGAACGAGAGACAAATCAAAATTTGGTTCCGAAACCGAAGGAAGAAAAAGAAAAAACTAAAACAAAGATCAAAACAAAGATTTGCCAACTTTCTTGTAACAAATTGGCAATTAAAAAAAAAGAATTGGTTTAACAATTTTGTTGGCAACGAACAAGGGTCACATAACAATTCAAAAATAAAAAATCAATTATTTTTGCCATCCCGACC
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCATTTCTGGGCCTCTCACCAATTACTTTGTACAGTCAATTATCAGCCCCGACACTGACGAGACTCCAGCAGCCAAATTCTCTGCGCAATTCCCCAACCCACGGGCCCCTGCGCAATCTGAACCCCTGGACTTTCCCTCCTGCAGTTTCAGCGCCTCCTGGAACCCCCTGACCCCGCACCCTCCAGTCTATCAGCCCTATATCCAACAGCAGCAGCAGCAGGAGGAGGGCGCCCCCAGTGCCGAGGGCAGGTACTTACGGGCTTGGCTGGACAATGGACCGAGTCTCAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGACAAACTGGGACCCCAACATTACACTGTGGCCTCGCCCGGCGGCGCTGCTGCAAATACTGAACGTTCCACTCACAGCGGCAACTTCCCCGACACTAAAGGGACTGAAGGAACCGCCGGGGACACTGACCGGACTCATCAAAACAACCCCTCAGCCAACTGGTTACACGCTCGCTCCTCCAGAAAGAAGAGGTGCCCCTACTCCAAATACCAGACCCTGGAGCTGGAGAAAGAATTCCTGTTTAACATGTACCTGACCAGGGACAGGAGGCACGAGGTCGCCAGGCTGTTGAACCTGAACGAGAGACAAATCAAAATTTGGTTCCGAAACCGAAGGAAGAAAAAGAAAAAACTAAAACAAAGATCAAAACAAAGATTTGCCAACTTTCTTGTAACAAATTGGCAATTAAAAAAAAAGAATTGGTTTAACAATTTTGTTGGCAACGAACAAGGGTCACATAACAATTCAAAAATAAAAAATCAATTATTTTTGCCATCCCGACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCATTTCTGGGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838016
dbEST ID: 79655718
Trimmed Sequence: ATCTTTGCTCTGATCTTTGTTTAGTTTCTTCATCTTCATCCTTCGGTTCTGGAACCAGATTTTGACTTGTCTCTCGCTCAGGTTCAACAGCCTGGCGACCTCGTGCCTCCTGTCCCTGGTCAGGTACATGTTAAACAGGAATTCCTTCTCCAGCTCCAGGGTCTGGTATTTGGAGTAGGGGCACCTCTTCTTTCTGGAGGAGCGAGCGTGTAACCAGTTGGCTGAGGGGTTGTTTTGATGAGTCCGGTCAGTGTCCCCGGCGGTTCCTTCAGTCCCTTTAGTGTCGGGGAAGTTGCCGCTGTGAGTGGAACGTTCAGTATTTGCAGCAGCGCCGCCGGGCGAGGCCACAGTGTAATGTTGGGGTCCCAGTTTGTCCCCCGCGGGCCCCACCAGCGGATCAAACATGAGAACTCATCCATTGTCCAGCCAAGCCCCGTAATACCTGGCCCTCGCCACTGGCGGCGCCCTCCTCCTGCTTCTGCTGCTGTTGCATATAGGACTGAGAGAACTAAAGGGTGCGGGGGTCGGGGGGTGCGGGGAAGGCGGTAGGGCTCCAAGAAGGGAGGGTCCGAGGGGTTCGAATGCCACGAGAGGCCCAGGGGGGTCGAGGAATAGGGGCGAAAAAAGTGGAAGGAAAGAAAGACGAGAGGCGGCATAGAGGGGGGGGGGGGTGGAAAAAAAAAGAGAAGAGGGGGAAAAAAAGTGGGAGGGAAAAGGGAGGGGTAGGAGGGAAGAGGGAGAGGGGGAGGGATGTTTATTAAGAGTGAAGGAGGAGGAGAGAGAGAGAAAAAACGCG
Full Trace Sequence: AAAGGCCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTTTGCTCTGATCTTTGTTTAGTTTCTTCATCTTCATCCTTCGGTTCTGGAACCAGATTTTGACTTGTCTCTCGCTCAGGTTCAACAGCCTGGCGACCTCGTGCCTCCTGTCCCTGGTCAGGTACATGTTAAACAGGAATTCCTTCTCCAGCTCCAGGGTCTGGTATTTGGAGTAGGGGCACCTCTTCTTTCTGGAGGAGCGAGCGTGTAACCAGTTGGCTGAGGGGTTGTTTTGATGAGTCCGGTCAGTGTCCCCGGCGGTTCCTTCAGTCCCTTTAGTGTCGGGGAAGTTGCCGCTGTGAGTGGAACGTTCAGTATTTGCAGCAGCGCCGCCGGGCGAGGCCACAGTGTAATGTTGGGGTCCCAGTTTGTCCCCCGCGGGCCCCACCAGCGGATCAAACATGAGAACTCATCCATTGTCCAGCCAAGCCCCGTAATACCTGGCCCTCGCCACTGGCGGCGCCCTCCTCCTGCTTCTGCTGCTGTTGCATATAGGACTGAGAGAACTAAAGGGTGCGGGGGTCGGGGGGTGCGGGGAAGGCGGTAGGGCTCCAAGAAGGGAGGGTCCGAGGGGTTCGAATGCCACGAGAGGCCCAGGGGGGTCGAGGAATAGGGGCGAAAAAAGTGGAAGGAAAGAAAGACGAGAGGCGGCATAGAGGGGGGGGGGGGTGGAAAAAAAAAGAGAAGAGGGGGAAAAAAAGTGGGAGGGAAAAGGGAGGGGTAGGAGGGAAGAGGGAGAGGGGGAGGGATGTTTATTAAGAGTGAAGGAGGAGGAGAGAGAGAGAAAAAACGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTTGCTCTGATCTTTGTTTAG