ORFeome > hoxd1 ORF1 – XORFeome v1.0

hoxd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxd1
Gene ID: 482735
Gene Page ID: 482730
ORF Xenbase ID: 17279517

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106402
Original XGC clone length: 903

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11067
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ834453
dbEST ID: 79652155
Trimmed Sequence: ATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTTTAGCTTTTTCACCCAAGTTCTGCCGCAGCGACCACAGAAACATGAACTTGCAGCCTTACCCTAGAAGTGGAGCAGATCATTCCTTTATGCCAGTCGGGGGTGTGCCCGGATCAGTTGCCCACCAGGCTCCACACCAGTCTCCAGCACTTTATGCTCCTTGCAGCCTGGATGTCGCCTATGAGCCGACCCCACCTTCTGACTACAGTTTCTTGCACAGCAGCCCCGATTACGATTATTATGGATCTAATCACCAGATAGAAGAGACTGGGGGGCACATTCCCTATGGTAGCTCACTATTTCCAGGCAATGGATCTTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACTCAAATGGCCCAGTGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCCTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCATCTGACAGCTATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCTCCTAAGAAGAGTATACCATCTGAATATGGGGTAACAAGTCCCCCCTGCAATGTGAGGACAAATTTCACCACCAAACAACTGACTGAGCTCGAAAAGGAGTTTCACTTTTACAAGTATCTTCACAGAACAAGGGCGCATCAAAATCGCAAACCTCTCTCCAGCTCAACGAAACCCAGGGTTAAGATCTGGGTTTCAAAACAAAAAAAATGAAAACAAAAAAAAAAAGGGAAAAAGGGAAAGGGAAAATTTTTGCCCCAA
Full Trace Sequence: GGGTCTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTTTAGCTTTTTCACCCAAGTTCTGCCGCAGCGACCACAGAAACATGAACTTGCAGCCTTACCCTAGAAGTGGAGCAGATCATTCCTTTATGCCAGTCGGGGGTGTGCCCGGATCAGTTGCCCACCAGGCTCCACACCAGTCTCCAGCACTTTATGCTCCTTGCAGCCTGGATGTCGCCTATGAGCCGACCCCACCTTCTGACTACAGTTTCTTGCACAGCAGCCCCGATTACGATTATTATGGATCTAATCACCAGATAGAAGAGACTGGGGGGCACATTCCCTATGGTAGCTCACTATTTCCAGGCAATGGATCTTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACTCAAATGGCCCAGTGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCCTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCATCTGACAGCTATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCTCCTAAGAAGAGTATACCATCTGAATATGGGGTAACAAGTCCCCCCTGCAATGTGAGGACAAATTTCACCACCAAACAACTGACTGAGCTCGAAAAGGAGTTTCACTTTTACAAGTATCTTCACAGAACAAGGGCGCATCAAAATCGCAAACCTCTCTCCAGCTCAACGAAACCCAGGGTTAAGATCTGGGTTTCAAAACAAAAAAAATGAAAACAAAAAAAAAAAGGGAAAAAGGGAAAGGGAAAATTTTTGCCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCCTACCTAGAATACACT

Sequences - 3ʹ (reverse) EST

Accession: JZ834454
dbEST ID: 79652156
Trimmed Sequence: GGGTGAAGCGTCCTTGGATGGCGACAGTGTCGCAGTCTCATTTACAGACTTCAAATGTGGAGGTTTTACGCAGAAGTTAGACGCGGGTCCGGATGGGGGAGAGTTGGGCAAAGTTCCCTCCCTTTCCCTTTTCTTTTGTTTCATTCTTCTGTTCTGGAACCAGATCTTAACCTGGGTATCGTTGAGCTGGAGAGAGTTTGCGATTTCGATGCGCCTTGCTCTTGTGAGATACTTGTTAAAGTGAAACTCCTTTTCGAGCTCAGTCAGTTGTTTGGTGGTGAAATTTGTCCTCACATTGCAGGGGGGACTTGTTACCCCATATTCAGATGGTATACTCTTCTTAGGAGGGTTCCTTTTAACTTTCATCCAATCAAACGTGCTGACATAGCTGTCAGATGCCGGGGAGGCAGGTTTTGGGTAAGTGCCAGGCGAGGGGGAGATACTCTGCAAGTTGCCCCCAGGATAAACTTCTAGTGGTTCCTTACACTGGGCCATTTGAGTTTCTTCTCCAAGAGTCCTGTAGCTCAGCTGCCCATTGAGGATGTAAGATCCATTGCCTGGAAATAGTGAGCTACCAAAGGGAATGTGCCCCCCAGTCTCTTCTATCCTGTGATTAGATCCATAATAAATCGTATCCGGGGCTGCGGGGCCAAAAAAATGTAATCAAAAGGTGGGGTCCGCTCATAAGGCCAACTTCCAGGCTGAAAGGGAACATAAAAGGCGTGGAGAACTGGGTTGTGGAACCCCTGGGTGGGGCAAAGTAAATTCCGG
Full Trace Sequence: GGCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGTGAAGCGTCCTTGGATGGCGACAGTGTCGCAGTCTCATTTACAGACTTCAAATGTGGAGGTTTTACGCAGAAGTTAGACGCGGGTCCGGATGGGGGAGAGTTGGGCAAAGTTCCCTCCCTTTCCCTTTTCTTTTGTTTCATTCTTCTGTTCTGGAACCAGATCTTAACCTGGGTATCGTTGAGCTGGAGAGAGTTTGCGATTTCGATGCGCCTTGCTCTTGTGAGATACTTGTTAAAGTGAAACTCCTTTTCGAGCTCAGTCAGTTGTTTGGTGGTGAAATTTGTCCTCACATTGCAGGGGGGACTTGTTACCCCATATTCAGATGGTATACTCTTCTTAGGAGGGTTCCTTTTAACTTTCATCCAATCAAACGTGCTGACATAGCTGTCAGATGCCGGGGAGGCAGGTTTTGGGTAAGTGCCAGGCGAGGGGGAGATACTCTGCAAGTTGCCCCCAGGATAAACTTCTAGTGGTTCCTTACACTGGGCCATTTGAGTTTCTTCTCCAAGAGTCCTGTAGCTCAGCTGCCCATTGAGGATGTAAGATCCATTGCCTGGAAATAGTGAGCTACCAAAGGGAATGTGCCCCCCAGTCTCTTCTATCCTGTGATTAGATCCATAATAAATCGTATCCGGGGCTGCGGGGCCAAAAAAATGTAATCAAAAGGTGGGGTCCGCTCATAAGGCCAACTTCCAGGCTGAAAGGGAACATAAAAGGCGTGGAGAACTGGGTTGTGGAACCCCTGGGTGGGGCAAAGTAAATTCCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTGAAGCGTCCTTGGAT