ORFeome > hoxd4 ORF1 – XORFeome v1.0

hoxd4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hoxd4
Gene ID: 6466680
Gene Page ID: 478961
ORF Xenbase ID: 17279541

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110765
Original XGC clone length: 714

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ838019
dbEST ID: 79655721
Trimmed Sequence: ATGGCCATGAGTTCGTACATGGTAAACTCTAAGTATGTGGATCCTAAATTCCCTCCATGCGAGGAGTATATGCAGGGCAGCTACCTGGCTGATCAGGGCTCTGATTTCTTCAGCCCTCCGGCTCAGGGCTCAGAGTACCAGCCACACCAGGGGATCTATGGCCGCTCACACTACAGCGACGAGTCGTTCAGTTGCAGCCAAGCTCAGAGCTCTGCTCTCCAGCCCCGGGGTCATGCACAGGAGCCCAGCGGCCCCCAGGAACCATTTGCAGCTGCTGATGACCATTGCCCTGCTCCAGCCACTCTCTCCAGCTCCCGAGGCTGCAGTCAGCAGCAGCACCCCAAAAATGGCACCCTGGGCAAACCCCCAGCCATAGTTTACCCCTGGATGAAAAAAGTCCATGTCAACTCAGTGAATCCAAATTACACTGGAGGGGAACCCAAACGATCCAGGACTGCTTACACCAGGCAGCAAGTCTTGGAACTGGAAAAGGAGTTTCATTTTAACAGGTATCTCACTCGACGTCGCCGGATAGAAATTGCCCATAGTCTGTGCTTGTCCGAACGCCAAATCAAAATCTGGTTTCAAAACAGGAGAATGAAATGGAAGAAAGACCACAAATTGCCCAACACCAAAGGCAGATCCACTTCTTCTTTATCCCAAACATACCACCTGGTTTCCAAAGACCAATAGAACGACCCTGACCTCTTTAATTGCCAACTTTCCTTGTCCAAAGTTGGCATTTAAAGAAAAACCATTGCCTAATAATTTTTGTTTTCAACCAAAACAGG
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCATGAGTTCGTACATGGTAAACTCTAAGTATGTGGATCCTAAATTCCCTCCATGCGAGGAGTATATGCAGGGCAGCTACCTGGCTGATCAGGGCTCTGATTTCTTCAGCCCTCCGGCTCAGGGCTCAGAGTACCAGCCACACCAGGGGATCTATGGCCGCTCACACTACAGCGACGAGTCGTTCAGTTGCAGCCAAGCTCAGAGCTCTGCTCTCCAGCCCCGGGGTCATGCACAGGAGCCCAGCGGCCCCCAGGAACCATTTGCAGCTGCTGATGACCATTGCCCTGCTCCAGCCACTCTCTCCAGCTCCCGAGGCTGCAGTCAGCAGCAGCACCCCAAAAATGGCACCCTGGGCAAACCCCCAGCCATAGTTTACCCCTGGATGAAAAAAGTCCATGTCAACTCAGTGAATCCAAATTACACTGGAGGGGAACCCAAACGATCCAGGACTGCTTACACCAGGCAGCAAGTCTTGGAACTGGAAAAGGAGTTTCATTTTAACAGGTATCTCACTCGACGTCGCCGGATAGAAATTGCCCATAGTCTGTGCTTGTCCGAACGCCAAATCAAAATCTGGTTTCAAAACAGGAGAATGAAATGGAAGAAAGACCACAAATTGCCCAACACCAAAGGCAGATCCACTTCTTCTTTATCCCAAACATACCACCTGGTTTCCAAAGACCAATAGAACGACCCTGACCTCTTTAATTGCCAACTTTCCTTGTCCAAAGTTGGCATTTAAAGAAAAACCATTGCCTAATAATTTTTGTTTTCAACCAAAACAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCATGAGTTCGTACA

Sequences - 3ʹ (reverse) EST

Accession: JZ838018
dbEST ID: 79655720
Trimmed Sequence: TAAAGAGGTCAGGTCAGTCTGATGGTCCTTGGAAACAGTTTGTATGTGTTGGGATAAAGAAGAAGTGGATCTGCCTTTGGTGTTGGGCAATTTGTGGTCTTTCTTCCATTTCATTCTCCTGTTTTGAAACCAGATTTTGATTTGGCGTTCGGACAAGCACAGACTATGGGCAATTTCTATCCGGCGACGTCAAGTGAGATACCTGTTAAAATGAAACTCCTTTTCCAGTTCCAAGACTTGCTGCCTGGTGTAAGCAGTCCTGGATCGTTTGGGTTCCCCTCCAGTGTAATTTGGATTCACTGAGTTGACATGGACTTTTTTCATCCANGGGTAAACTATGGCTGGGGGTTTGCCCAGGCTGCCATTTTTGCGGTGCTGCTGCGGACTGGAGCCTCACCAACTGGAGAGAGAAACTGGAGCAGGACAATGGTAATCATCAAACTACAATGGTTCCTTGAAGGGGGCTGGGCTCCTGTGCACGAGCGCCAGGGCTGGGGAGCAGAGCGCTCACTCTCGGCGGGGGGTGAGCAAATCGTGGTCTGAAGGGGAGAGGGGGGGGGAGAAACCTGACTGTGGGGGGGTGGTGTAAGCCGTGGGCCGGGGGGGCTGGGGGAAAGAAAAAGCCACCCCCAGCCCGGGGCGGGGCCCGGGCCGCGGCGGCCCGCCCGTGCCCGGGAAGGGGGGGGAGGGGGGGACATGCAAATTAAAAAGAAATAAAAAAAACAACGGCAGAAACCCCCGGGGGGGGGGGGTGTTGGGGAAATTTTCGGTTGTGGGGAAAAAAATTAGGGAG
Full Trace Sequence: AAACCGTCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAAGAGGTCAGGTCAGTCTGATGGTCCTTGGAAACAGTTTGTATGTGTTGGGATAAAGAAGAAGTGGATCTGCCTTTGGTGTTGGGCAATTTGTGGTCTTTCTTCCATTTCATTCTCCTGTTTTGAAACCAGATTTTGATTTGGCGTTCGGACAAGCACAGACTATGGGCAATTTCTATCCGGCGACGTCAAGTGAGATACCTGTTAAAATGAAACTCCTTTTCCAGTTCCAAGACTTGCTGCCTGGTGTAAGCAGTCCTGGATCGTTTGGGTTCCCCTCCAGTGTAATTTGGATTCACTGAGTTGACATGGACTTTTTTCATCCANGGGTAAACTATGGCTGGGGGTTTGCCCAGGCTGCCATTTTTGCGGTGCTGCTGCGGACTGGAGCCTCACCAACTGGAGAGAGAAACTGGAGCAGGACAATGGTAATCATCAAACTACAATGGTTCCTTGAAGGGGGCTGGGCTCCTGTGCACGAGCGCCAGGGCTGGGGAGCAGAGCGCTCACTCTCGGCGGGGGGTGAGCAAATCGTGGTCTGAAGGGGAGAGGGGGGGGGAGAAACCTGACTGTGGGGGGGTGGTGTAAGCCGTGGGCCGGGGGGGCTGGGGGAAAGAAAAAGCCACCCCCAGCCCGGGGCGGGGCCCGGGCCGCGGCGGCCCGCCCGTGCCCGGGAAGGGGGGGGAGGGGGGGACATGCAAATTAAAAAGAAATAAAAAAAACAACGGCAGAAACCCCCGGGGGGGGGGGGTGTTGGGGAAATTTTCGGTTGTGGGGAAAAAAATTAGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAAGAGGTCAGGTCAGTC