ORFeome > hpgds ORF1 – XORFeome v1.0

hpgds ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hpgds
Gene ID: 944784
Gene Page ID: 944777
ORF Xenbase ID: 17279571

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053774
Original XGC clone length: 594

Human orthology & disease relationships

NCBI Entrez ID: 27306
Ensembl gene IDs: ENSG00000163106
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 123320,131760,131800,131900,131960,179850,192600,601419,604370,604765,606072,607801,607907,608747,608758,609040,609352

Library Location

Plate ID: GDExl11001
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ839188
dbEST ID: 79656890
Trimmed Sequence: ATGCCCAGCTACAAGCTTATCTATTTTAATCTTGAAGGAAGAGGAGAGATCCTTCGCTACTTATTTTCTTATTCAAACATTGACTTTGAAGACCGCAGAGTTGAATTTGCTGACTGGCCTGCACTTAAACCTACAATTCCTTACGGCCAGCTTCCAGTTGTAGAAATTGATGGGGTCATCTATAACCAGAGCCTTGCTATTGGACGCTACTTGGCTAAAAAAGCAGGACTGACTGGAAAAAGTGAATTGGATGAAATCCGTGTTGATGCCTTAATAGATACCATTGATGACTTCTTCTCAAAGTTCCCTTGGATGGACACTGAAAAAGCCAAAAAGGAATTCATGGAGAAGTCTAGTCCACAGTTGCTGGCTTACTTGGAAAAAACTCTAGGCAATAACCCTTGGTTTGTTGGTGACTCTGCAACCTGGGCTGACTTTTTCTGGGACACCTGTGCTGATAGTTTTGAAAGCTATGTACCCGGCTTTGCCAAAGACTATCCAAAGCTGCTGGCTCTGAAGGAAAGAGTTAAAGCCATTCCCACCATTGCTGCATGGATTAGGAAGAGACCCAAAAAAATCCCAGTAAAACATTT
Full Trace Sequence: TTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAGCTACAAGCTTATCTATTTTAATCTTGAAGGAAGAGGAGAGATCCTTCGCTACTTATTTTCTTATTCAAACATTGACTTTGAAGACCGCAGAGTTGAATTTGCTGACTGGCCTGCACTTAAACCTACAATTCCTTACGGCCAGCTTCCAGTTGTAGAAATTGATGGGGTCATCTATAACCAGAGCCTTGCTATTGGACGCTACTTGGCTAAAAAAGCAGGACTGACTGGAAAAAGTGAATTGGATGAAATCCGTGTTGATGCCTTAATAGATACCATTGATGACTTCTTCTCAAAGTTCCCTTGGATGGACACTGAAAAAGCCAAAAAGGAATTCATGGAGAAGTCTAGTCCACAGTTGCTGGCTTACTTGGAAAAAACTCTAGGCAATAACCCTTGGTTTGTTGGTGACTCTGCAACCTGGGCTGACTTTTTCTGGGACACCTGTGCTGATAGTTTTGAAAGCTATGTACCCGGCTTTGCCAAAGACTATCCAAAGCTGCTGGCTCTGAAGGAAAGAGTTAAAGCCATTCCCACCATTGCTGCATGGATTAGGAAGAGACCCAAAAAAATCCCAGTAAAACATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCATTTTGTTGCAACGAAACAGTCACTATCCAGTCAAATAAAATCATTATTTGCCATCCACCTGAAATCCCCCAATGGTGAGTCCTAATACATGGGAAAAAAAAGGTTTCCTGGAAGCTTCTGGCCCGGGGTCCAAAACTCCCCCCAAAGTTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAGCTACAAGCTTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839187
dbEST ID: 79656889
Trimmed Sequence: ATGTTTTACTGGGATTTTTTTGGGTCTCTTCTTAATCCATGCAGCAATGGTGGGAATGGCTTTAACTCTTTCCTTCAGAGCCAGCAGCTTTGGATAGTCTTTGGCAAAGCCGGGTACATAGCTTTCAAAACTATCAGCACAGGTGTCCCAGAAAAAGTCAGCCCAGGTTGCAGAGTCACCAACAAACCAAGGGTTATTGCCTAGAGTTTTTTCCAAGTAAGCCAGCAACTGTGGACTAGACTTCTCCATGAATTCCTTTTTGGCTTTTTCAGTGTCCATCCAAGGGAACTTTGAGAAGAAGTCATCAATGGTATCTATTAAGGCATCAACACGGATTTCATCCAATTCACTTTTTCCAGTCAGTCCTGCTTTTTTAGCCAAGTAGCGTCCAATAGCAAGGCTCTGGTTATAGATGACCCCATCAATTTCTACAACTGGAAGCTGGCCGTAAGGAATTGTAGGTTTAAGTGCAGGCCAGTCAGCAAATTCAACTCTGCGGTCTTTCAAGTCAATGTTTGAATAAAAAAATAAGTACCGAAGGAACTCTTCTCTTCCTTTAAGATTAAAATAAATAAGCTTGTAACTGGGGCAGGGTGGC
Full Trace Sequence: CGGGAAACTGCTATGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTTTTACTGGGATTTTTTTGGGTCTCTTCTTAATCCATGCAGCAATGGTGGGAATGGCTTTAACTCTTTCCTTCAGAGCCAGCAGCTTTGGATAGTCTTTGGCAAAGCCGGGTACATAGCTTTCAAAACTATCAGCACAGGTGTCCCAGAAAAAGTCAGCCCAGGTTGCAGAGTCACCAACAAACCAAGGGTTATTGCCTAGAGTTTTTTCCAAGTAAGCCAGCAACTGTGGACTAGACTTCTCCATGAATTCCTTTTTGGCTTTTTCAGTGTCCATCCAAGGGAACTTTGAGAAGAAGTCATCAATGGTATCTATTAAGGCATCAACACGGATTTCATCCAATTCACTTTTTCCAGTCAGTCCTGCTTTTTTAGCCAAGTAGCGTCCAATAGCAAGGCTCTGGTTATAGATGACCCCATCAATTTCTACAACTGGAAGCTGGCCGTAAGGAATTGTAGGTTTAAGTGCAGGCCAGTCAGCAAATTCAACTCTGCGGTCTTTCAAGTCAATGTTTGAATAAAAAAATAAGTACCGAAGGAACTCTTCTCTTCCTTTAAGATTAAAATAAATAAGCTTGTAACTGGGGCAGGGTGGCCAACTTTTTTGTACAAAGGTTGGCATTAAAAAAAAAGCATTGCTCAATCATTTTTTGCCAAACGAAACAGTCACCAATCAATCAAAATAAAAATCAAAAATTATGCGAGCCCAAAGCTTAAAAAATGGGGCCGTGGTTTTAAAAAATCCTTGTGAAAATGGGGGGAGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTTTTACTGGGATTTTTTTGGG