ORFeome > hsd11b1 ORF1 – XORFeome v1.0

hsd11b1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hsd11b1
Gene ID: 960494
Gene Page ID: 960490
ORF Xenbase ID: 17279643

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054291
Original XGC clone length: 885

Human orthology & disease relationships

NCBI Entrez ID: 3290
Ensembl gene IDs: ENSG00000117594
Directly associated (OMIM) disease MIM numbers: 614662
Indirectly associated (Lage, et al.) disease MIM numbers: 103900,203400,604931

Library Location

Plate ID: GDExl11002
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ839341
dbEST ID: 79657043
Trimmed Sequence: ATGGCTGTGCTCAAAGTGCTTGTTGCTTTTGCTGGAATCTTTCTCGCTGTTTACTTTTATTCAGCAGGGGATGTCTTTGAACCGGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCAGGAATTGGAGAGCAAATGGCATATCATCTGGCCAAGATGGGGTCTCATATTCTCATAACAGCAAGGACAGAAGAGAAACTTAAGAAGGTAGTTGCGCAGTGTACACAGCTGGGAGCTGCTTCTGCTCATTACATTGCCGGCAGCATGGACAATTTGACATTTGCAAAGCAAGTAGTGCACAAAGCTGAGAACTTATTTGGTGCGTTGGACATGCTTATCTTAAATCACATTGGTCACACATACTTTGGTTACTTTGATGGCAATGTGGATCATGTAAGAGGTCTATTAGAGATCAATGTCCTGAGTTACGCTACCATGACAGTAGCTGCACTTCCGATGCTAAAAAAAAGCAACGGGAATATTGTGGTTGTCTCATCAATTGCAGGTAAAATTGGACTCCCTCTATCTGTGCCATACTCTACTACCAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACACTAATGTTTCTATTACACTATGCGTCATCAGCTATATTGACACAGATAGTGCTGTAAAAACTGTGTCAGGTGTAATCCAGCACCAGCAGCCTCCAAAAGAAGATTGCGCACTTAAAATTTTAAAAGGGGGATCACTCCCAAAAAAGGAAAATTTAATAACAAAAATCTGGCCCACCAAGAATTCCCACTTCCCTGCTCAAA
Full Trace Sequence: CGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGTGCTCAAAGTGCTTGTTGCTTTTGCTGGAATCTTTCTCGCTGTTTACTTTTATTCAGCAGGGGATGTCTTTGAACCGGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCAGGAATTGGAGAGCAAATGGCATATCATCTGGCCAAGATGGGGTCTCATATTCTCATAACAGCAAGGACAGAAGAGAAACTTAAGAAGGTAGTTGCGCAGTGTACACAGCTGGGAGCTGCTTCTGCTCATTACATTGCCGGCAGCATGGACAATTTGACATTTGCAAAGCAAGTAGTGCACAAAGCTGAGAACTTATTTGGTGCGTTGGACATGCTTATCTTAAATCACATTGGTCACACATACTTTGGTTACTTTGATGGCAATGTGGATCATGTAAGAGGTCTATTAGAGATCAATGTCCTGAGTTACGCTACCATGACAGTAGCTGCACTTCCGATGCTAAAAAAAAGCAACGGGAATATTGTGGTTGTCTCATCAATTGCAGGTAAAATTGGACTCCCTCTATCTGTGCCATACTCTACTACCAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACACTAATGTTTCTATTACACTATGCGTCATCAGCTATATTGACACAGATAGTGCTGTAAAAACTGTGTCAGGTGTAATCCAGCACCAGCAGCCTCCAAAAGAAGATTGCGCACTTAAAATTTTAAAAGGGGGATCACTCCCAAAAAAGGAAAATTTAATAACAAAAATCTGGCCCACCAAGAATTCCCACTTCCCTGCTCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGTGCTCAAAGTGCTTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839340
dbEST ID: 79657042
Trimmed Sequence: AACTTCTCTCCTCTGAAAATTGTCCATGTTATAATTCTTAAGGAGAAGAGACTGTAATAATTCTGGTGCCCAGTCTCTGAGCAGGAGTGGAATCTTGGTGGCATGATATTGATAGTAAACTTCCCTTTTTCGGAGTGATCCACCTTTTATAATTTCGAGTGCGCACTCTTCTTTAGGAGCTGCTGGTTGCTGGATTACACCTGACACAGTTTTTACAGCACTATCTGTGTCAATATAGCTGATGACGCATAGTGTAATAGAAACATTAGTGTTTTGCTGGATAAACTCCATTCGCAATGAGCTGAAAAATCCATCCAGTGCAAATTTGGTAGTAGAGTATGGCACAGATAGAGGGAGTCCAATTTTACCTGCAATTGATGAGACAACCACAATATTCCCGTTGCTTTTTTTTAGCATCGGAAGTGCAGCTACTGTCATGGTAGCGTAACTCAGGACATTGATCTCTAATAGACCTCTTACATGATCCACATTGCCATCAAAGTAACCAAAGTAAGTGTGACCAATGTGATTTAAGATAAGCATGTCCAACGCACCCAAAAAGTTCTCAGCTTTGTGCACTAACTTGCTTTGCAAATGGCAAATTGTCCATGCTGCCCGCAAAGGAATGAGCAGAAGCAGCCTCCAGCTGTGGAAACCGGGCCAACTACCTTTCCTAAATTTTTTCTTCTGTCCCTTGCTGTTTTGGAAAAAAAGAAAAACCCCCACCTTGGGGCCAAAAAAAAATTTCCCAATTTGGTTTCTCCCAAAT
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTTCTCTCCTCTGAAAATTGTCCATGTTATAATTCTTAAGGAGAAGAGACTGTAATAATTCTGGTGCCCAGTCTCTGAGCAGGAGTGGAATCTTGGTGGCATGATATTGATAGTAAACTTCCCTTTTTCGGAGTGATCCACCTTTTATAATTTCGAGTGCGCACTCTTCTTTAGGAGCTGCTGGTTGCTGGATTACACCTGACACAGTTTTTACAGCACTATCTGTGTCAATATAGCTGATGACGCATAGTGTAATAGAAACATTAGTGTTTTGCTGGATAAACTCCATTCGCAATGAGCTGAAAAATCCATCCAGTGCAAATTTGGTAGTAGAGTATGGCACAGATAGAGGGAGTCCAATTTTACCTGCAATTGATGAGACAACCACAATATTCCCGTTGCTTTTTTTTAGCATCGGAAGTGCAGCTACTGTCATGGTAGCGTAACTCAGGACATTGATCTCTAATAGACCTCTTACATGATCCACATTGCCATCAAAGTAACCAAAGTAAGTGTGACCAATGTGATTTAAGATAAGCATGTCCAACGCACCCAAAAAGTTCTCAGCTTTGTGCACTAACTTGCTTTGCAAATGGCAAATTGTCCATGCTGCCCGCAAAGGAATGAGCAGAAGCAGCCTCCAGCTGTGGAAACCGGGCCAACTACCTTTCCTAAATTTTTTCTTCTGTCCCTTGCTGTTTTGGAAAAAAAGAAAAACCCCCACCTTGGGGCCAAAAAAAAATTTCCCAATTTGGTTTCTCCCAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTTCTCTCCTCTGAAAATTGTC