ORFeome > hsd11b1l.2 ORF1 – XORFeome v1.0

hsd11b1l.2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hsd11b1l.2
Gene ID: 5834075
Gene Page ID: 5834067
ORF Xenbase ID: 17279655

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054284
Original XGC clone length: 876

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ839269
dbEST ID: 79656971
Trimmed Sequence: ATGGCTGGGGTAATATTACTGCTTCTGTCTCTGTGTGTTGGGTACATTGCTTATTACTTCTTTCGCACTGACTCCATGAACAAAGAATCAGTTCGTGGGAAGCGTGTACTAATAACAGGATCCAGCACTGGCCTTGGAGAGCAGATCGCTTATGAATTTGCTCGGATGGGGGCACATATAATGATCACAGCTAGAAGACTTCAGCAGTTGCAAGAAGTGGCAAGCCAATGTATGAAGTTAGGAGCTGCCTCTGCACACTATGTGGCCTCTGATATGGGAAACTTGGAATCAGCACAGTCTGTGGCCCAAGAAGCAGTGGTCAAGCTTGGAGGCTTGGATTACTTGGTTCTGAATCACATTGGTGGATCTGGATGATTTGGATTTTTCAAAGGTGACATGGATCCAGTTGTAAGATCTACTACCGTGAGCTTCCTTAGCTATGTCCAGCTTACTTCTTCTGCACTGAGCGCCCTGCAAGAATCACAATGAAGCATTGTTGTCATATCCTCAATGAGTGGTCGCATTGGGGCTCCTTTCACTACCAGCTATTGTGCATCCAACTTTGCCCTGGAAAGGTTCTACAGCTCTCTCCGCATAAAATTTGCTCTTCCAAATAACCAAATGTCTGTGACTGTGCCTGTTCTTGAAAAATTTAATCTAAAAAATGCATAAAAAAAGTTGTAAAAAAGTGGTCCAGAACACCCTCATCAAAAAAAAAAATGGCCCCGTAAAAATGTCAAAATCACCTGTGCTTACACAACCCGAAAAATTTTTTTTTTCATTTTTCGGGGGCCTTTTTAACCCCATTTT
Full Trace Sequence: GGTTTTATGCCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGTAATATTACTGCTTCTGTCTCTGTGTGTTGGGTACATTGCTTATTACTTCTTTCGCACTGACTCCATGAACAAAGAATCAGTTCGTGGGAAGCGTGTACTAATAACAGGATCCAGCACTGGCCTTGGAGAGCAGATCGCTTATGAATTTGCTCGGATGGGGGCACATATAATGATCACAGCTAGAAGACTTCAGCAGTTGCAAGAAGTGGCAAGCCAATGTATGAAGTTAGGAGCTGCCTCTGCACACTATGTGGCCTCTGATATGGGAAACTTGGAATCAGCACAGTCTGTGGCCCAAGAAGCAGTGGTCAAGCTTGGAGGCTTGGATTACTTGGTTCTGAATCACATTGGTGGATCTGGATGATTTGGATTTTTCAAAGGTGACATGGATCCAGTTGTAAGATCTACTACCGTGAGCTTCCTTAGCTATGTCCAGCTTACTTCTTCTGCACTGAGCGCCCTGCAAGAATCACAATGAAGCATTGTTGTCATATCCTCAATGAGTGGTCGCATTGGGGCTCCTTTCACTACCAGCTATTGTGCATCCAACTTTGCCCTGGAAAGGTTCTACAGCTCTCTCCGCATAAAATTTGCTCTTCCAAATAACCAAATGTCTGTGACTGTGCCTGTTCTTGAAAAATTTAATCTAAAAAATGCATAAAAAAAGTTGTAAAAAAGTGGTCCAGAACACCCTCATCAAAAAAAAAAATGGCCCCGTAAAAATGTCAAAATCACCTGTGCTTACACAACCCGAAAAATTTTTTTTTTCATTTTTCGGGGGCCTTTTTAACCCCATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGTAATATTACTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839268
dbEST ID: 79656970
Trimmed Sequence: TTGGATGTTTTCTAAGATGTAGCATTTATCATGTATTTTTGCCACCGCCCCCGGAAACCAGTCTCTCAGTAAAACGAATGGCTTAATGCCCCAGTAAGGATAAAAAATTTCCGGTTGTTGTAGGACAGCTGCTTTGACCACTTCACGTGCACAGTCTTCTTTTGATGAAGCTGTCATGGACACTTTATAAAAAACATTCATGACAGCATTTTCTGTATGCACTGCGGCACAGAACGGCCACAGTCACAGACAATGGGCCATTCTGAAGAGTGGAGTCTCTGTGTACACAGCTGTGTAGACGGTCAACGGCCTCATGACAGGGACGATACCTCGTGGAGAGAAGATCGCCCTTGCGAACACACCGTAGGCACAGGACCACAATGCTTCCATGCGAGTCCTGCAGCGCGCTCGGTGCCGAAGAATTGAGCGGTACATATCTTATGATATTCACATTATTATAGCCTACCACCGCATCCACGTCACCTCTTGAAAATCCAAATCCTCCAGAGCCAGCACATATAATTCAAAACCCAGTACTCCCACCCTCCTAACCTGACCACTGCTTCTTGGGACACGAACTGTGCTGATTTCTAGGTTACCATATCATAAGCCACGTAGTGTGCAAAAGCAACTCCCAGACTTCAACATTGCCTTGCCACTTCTGCACCTGCTGAAGTCTTCCTGCTTGGAACAATATATGTGCCCCCAATCGAAGCAAATTTAATAAGCACCCTCGCCCTCCAAGGGCGGTGGCTGGGATCCGGGTTATAGATACAGCGCGT
Full Trace Sequence: GAAGCCGGCTACGAACCATGTAAAACGACTCACTAGACGGGGAGACCAGCCCGGAGGGCAAAAACGAGCCCATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGATGTTTTCTAAGATGTAGCATTTATCATGTATTTTTGCCACCGCCCCCGGAAACCAGTCTCTCAGTAAAACGAATGGCTTAATGCCCCAGTAAGGATAAAAAATTTCCGGTTGTTGTAGGACAGCTGCTTTGACCACTTCACGTGCACAGTCTTCTTTTGATGAAGCTGTCATGGACACTTTATAAAAAACATTCATGACAGCATTTTCTGTATGCACTGCGGCACAGAACGGCCACAGTCACAGACAATGGGCCATTCTGAAGAGTGGAGTCTCTGTGTACACAGCTGTGTAGACGGTCAACGGCCTCATGACAGGGACGATACCTCGTGGAGAGAAGATCGCCCTTGCGAACACACCGTAGGCACAGGACCACAATGCTTCCATGCGAGTCCTGCAGCGCGCTCGGTGCCGAAGAATTGAGCGGTACATATCTTATGATATTCACATTATTATAGCCTACCACCGCATCCACGTCACCTCTTGAAAATCCAAATCCTCCAGAGCCAGCACATATAATTCAAAACCCAGTACTCCCACCCTCCTAACCTGACCACTGCTTCTTGGGACACGAACTGTGCTGATTTCTAGGTTACCATATCATAAGCCACGTAGTGTGCAAAAGCAACTCCCAGACTTCAACATTGCCTTGCCACTTCTGCACCTGCTGAAGTCTTCCTGCTTGGAACAATATATGTGCCCCCAATCGAAGCAAATTTAATAAGCACCCTCGCCCTCCAAGGGCGGTGGCTGGGATCCGGGTTATAGATACAGCGCGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGATGTTTTCTAAGATGTAGCA