ORFeome > hsf2 ORF1 – XORFeome v1.0

hsf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hsf2
Gene ID: 954983
Gene Page ID: 954976
ORF Xenbase ID: 17279727

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126036
Original XGC clone length: 1548

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ837566
dbEST ID: 79655268
Trimmed Sequence: ATGAAGCAGAACTCGAATGTTCCGGCATTTCTCAGCAAGCTTTGGACTTTAGTGGAGGATTCTGACACAAACGAGTTCATTACTTGGAGTCAGAATGGACAGAGCTTTTTGGTTCTTGACGAGCAGCGGTTTGCTAAAGAGATTCTACCAAAGTATTTCAAGCACAACAACATGGCTAGCTTTGTAAGACAATTAAACATGTATGGTTTCCGTAAAGTGGTACATATAGACTCTGGCATTGTTAAGCAAGAGCGGGATGGACCAGTGGAATTTCAACACCCATTCTTTGTCCAAGGGCAGGATGAATTATTGGAAAATATAAAGAGGAAGGTGTCCTCAACAAGACCAGAAGAAGGCAAAGTGTGCCAGGAAGATATATCGACAATTTTAAGCAATGCTGCAAAGGTCCAAGTCCAACAAGAAACTATTGATTTGCGATTGTTTACATTAAAAAGGGACAACGAAGCTTTGTGGAGAGAAATATCTGACTTGCGTAACAAACATGTCCAGCAGCAACAAGTTATTCGAAAGATTGTGCAGTTTATTGTGACTCTGGTGCAGAGAAACAGATTAGTCAGTCTATAGAGAAAACAGCCGTTACTTTTGAACACAAATAACTCTCCCAAATCCACGCGCCTAGCGACGATTGGTTAGGGAGACAGTGGGAAGATAATCATCAATGTTTTCCTTTCTTATTGAATGGTTGAGAAAGAGGAAAACC
Full Trace Sequence: GAGGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCAGAACTCGAATGTTCCGGCATTTCTCAGCAAGCTTTGGACTTTAGTGGAGGATTCTGACACAAACGAGTTCATTACTTGGAGTCAGAATGGACAGAGCTTTTTGGTTCTTGACGAGCAGCGGTTTGCTAAAGAGATTCTACCAAAGTATTTCAAGCACAACAACATGGCTAGCTTTGTAAGACAATTAAACATGTATGGTTTCCGTAAAGTGGTACATATAGACTCTGGCATTGTTAAGCAAGAGCGGGATGGACCAGTGGAATTTCAACACCCATTCTTTGTCCAAGGGCAGGATGAATTATTGGAAAATATAAAGAGGAAGGTGTCCTCAACAAGACCAGAAGAAGGCAAAGTGTGCCAGGAAGATATATCGACAATTTTAAGCAATGCTGCAAAGGTCCAAGTCCAACAAGAAACTATTGATTTGCGATTGTTTACATTAAAAAGGGACAACGAAGCTTTGTGGAGAGAAATATCTGACTTGCGTAACAAACATGTCCAGCAGCAACAAGTTATTCGAAAGATTGTGCAGTTTATTGTGACTCTGGTGCAGAGAAACAGATTAGTCAGTCTATAGAGAAAACAGCCGTTACTTTTGAACACAAATAACTCTCCCAAATCCACGCGCCTAGCGACGATTGGTTAGGGAGACAGTGGGAAGATAATCATCAATGTTTTCCTTTCTTATTGAATGGTTGAGAAAGAGGAAAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCAGAACTCGAATGTTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837565
dbEST ID: 79655267
Trimmed Sequence: ATCCAGCAGTGGCATATCATTGTCCAGAGGGGCTGGTGCCAGTTCACATAAATAGAAAAGGGTAGCCTCACTGGCCTCTGCTTCCGACAGTGGTTCAAGACGCATTAATTTGCTTTGTGGTGGAGAGTCCAAGTTGGATTCCAGAAGCTGGTCTTCAAGTGGTTTGTCTGGTGGTGTGTCTGTTGTTAAATTTCCACTGTCCCCGTCAAAAAGAGCCAGAAGTGGAAATGAAGTGTATTGCACAAGCTGATGATCAGATTTATGGTTATCCCCACTGGAATTTGCAGGTCCTGGGACAACACCACAGCTCTTCAGAGATTCAATGCCTTTACTTTCCAGATCTACCAGCAGATCTCGGTCTATGCTGAATTGACGCCCAGACAGTAAAGCTTTGAAATCATCCAACGTGCAATCAATGCTGTCTAAGTAATCCATCAGCTCAACTTTTCCAAGAAGGTTGAGGTTTTGAGAAATAACGCCACTTTCATTAAGAATGGAATCCATCANTGTAACTGGATCCTCTAAATTAAAAGAAAACTGGCTGTTGAGCTGTAGGGCACTTGACATCAGAAGAAACAGACGTGTTCTCACCAACAAGGGCTACCAAGACCAATCTCAACAATTTTTTTTTCCTTTGCCAACTTGGAAGCGGCCTGCGTAATCCACCATCAATCTTTCCACTAATAAAAAATTTTCCGGGGTGAAAAACCTGC
Full Trace Sequence: GGCGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCAGCAGTGGCATATCATTGTCCAGAGGGGCTGGTGCCAGTTCACATAAATAGAAAAGGGTAGCCTCACTGGCCTCTGCTTCCGACAGTGGTTCAAGACGCATTAATTTGCTTTGTGGTGGAGAGTCCAAGTTGGATTCCAGAAGCTGGTCTTCAAGTGGTTTGTCTGGTGGTGTGTCTGTTGTTAAATTTCCACTGTCCCCGTCAAAAAGAGCCAGAAGTGGAAATGAAGTGTATTGCACAAGCTGATGATCAGATTTATGGTTATCCCCACTGGAATTTGCAGGTCCTGGGACAACACCACAGCTCTTCAGAGATTCAATGCCTTTACTTTCCAGATCTACCAGCAGATCTCGGTCTATGCTGAATTGACGCCCAGACAGTAAAGCTTTGAAATCATCCAACGTGCAATCAATGCTGTCTAAGTAATCCATCAGCTCAACTTTTCCAAGAAGGTTGAGGTTTTGAGAAATAACGCCACTTTCATTAAGAATGGAATCCATCANTGTAACTGGATCCTCTAAATTAAAAGAAAACTGGCTGTTGAGCTGTAGGGCACTTGACATCAGAAGAAACAGACGTGTTCTCACCAACAAGGGCTACCAAGACCAATCTCAACAATTTTTTTTTCCTTTGCCAACTTGGAAGCGGCCTGCGTAATCCACCATCAATCTTTCCACTAATAAAAAATTTTCCGGGGTGAAAAACCTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCAGCAGTGGCATATCATT