ORFeome > hsp90b1 ORF1 – XORFeome v1.0

hsp90b1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hsp90b1
Gene ID: 866383
Gene Page ID: 494759
ORF Xenbase ID: 17279751

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129528
Original XGC clone length: 2418

Human orthology & disease relationships

NCBI Entrez ID: 7184
Ensembl gene IDs: ENSG00000166598
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105200,144010,172800,200100,205400,227650,604091,606843

Library Location

Plate ID: GDExl11091
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ838737
dbEST ID: 79656439
Trimmed Sequence: ATGAGGAAGTCTTGGGCAATCGGTCTTTGTTGCATCTTATTGGCATTCGCATCTGTTCAAGCGGAAGATGAAGTTGAAGTGGATGCAACTGTAGAAGATGATATTGGAAAAAGTAGAGACGGATCTCGAACAGATGACGAAGTTGTAAGCAGGGAAGAGGAAGCTATCCCGTTAGATGGACTCAATGCTGCTCAAATTAAGGAAATCCGGGAGAAATCAGAGAAATTTGCATTTCAGGCGTCCAGCACTTCGTAGGTTTCTTCAAGGGTGTAAGGCGCAATGGTGGCAAATGTCTGCTCTTTATCCCACGGGCAGCCGTTTTCCGGATCGCGCAGGCGCTGCATAATAGTGAGCAAACGGTCGATTTGATTCATTGAATTGTCCTGAAGATTGCGGGTCTGTCAGACCGAAAAAGATGCTTCCTCTAATTATTATTCAAGCCAGAAGAAGACATTTGAAATAAATCCAAGACATCCTTTGATCCATGATATGTTAATAAGAGTAAAGGAAAACGAAGACGAACAAACTGTAGCAGACCTTGCGGTCGTACTCTTATAAACTGGCAGTCTACATTCAGGAATACAGATGTCTGATACTAGAGAATATGGGAAAAGGAATTGGGAGAATGGGGGCGGGGAAGCTTAAAAATTTGTGTTTGAAGTCTTTAGGTGTGTTGTAGAGCCAAAAAAAAGGAAAAATCAGGGTGTCGTGATTGTTTTGAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGAAGTCTTGGGCAATCGGTCTTTGTTGCATCTTATTGGCATTCGCATCTGTTCAAGCGGAAGATGAAGTTGAAGTGGATGCAACTGTAGAAGATGATATTGGAAAAAGTAGAGACGGATCTCGAACAGATGACGAAGTTGTAAGCAGGGAAGAGGAAGCTATCCCGTTAGATGGACTCAATGCTGCTCAAATTAAGGAAATCCGGGAGAAATCAGAGAAATTTGCATTTCAGGCGTCCAGCACTTCGTAGGTTTCTTCAAGGGTGTAAGGCGCAATGGTGGCAAATGTCTGCTCTTTATCCCACGGGCAGCCGTTTTCCGGATCGCGCAGGCGCTGCATAATAGTGAGCAAACGGTCGATTTGATTCATTGAATTGTCCTGAAGATTGCGGGTCTGTCAGACCGAAAAAGATGCTTCCTCTAATTATTATTCAAGCCAGAAGAAGACATTTGAAATAAATCCAAGACATCCTTTGATCCATGATATGTTAATAAGAGTAAAGGAAAACGAAGACGAACAAACTGTAGCAGACCTTGCGGTCGTACTCTTATAAACTGGCAGTCTACATTCAGGAATACAGATGTCTGATACTAGAGAATATGGGAAAAGGAATTGGGAGAATGGGGGCGGGGAAGCTTAAAAATTTGTGTTTGAAGTCTTTAGGTGTGTTGTAGAGCCAAAAAAAAGGAAAAATCAGGGTGTCGTGATTGTTTTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGAAGTCTTGGGCAATCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838736
dbEST ID: 79656438
Trimmed Sequence: CAGTTCATCTTTTACATCTGTGGATTCCTGTGTGTCTGTTTCTTCTGTTTGTGGTTTTTCCTCACCCTCTTCGGCATCAACCTCTTCCACATCTTCAGAATCATCCTGATCATCATCATCTGCAGCAGGCTCTTCCTCTTCTGGCTCTTCATCCACCTGAGCATCAAGGTCAATCTTTAAGCTTAGGCGCAGCATTCTTTCAATCCTGTCTCCATATCCTTTAGTATCAGACAACTGATATCCTGAACGTAGAGTGGCAGTTTCTAAGAGTACGACTGCAAGGTCTGCTACAGTCTGATCGTCTTCGTTTTCCTTTACTCTTCTTAACATATCCTTGATCAAAGGATGTCTTGGATTTATTTCAAATGTCTTCTTCTGGCTTGAATAATAATTTGTGGAAGCATCTTTTCCGGTCTGACAGACCCGCAATTTTCTTGACAATTCAATGAATCAAAACGACCCTTTGCTCACTATTATGCATCGCCGGCGCGATCCAGACAACAGCTGCCCGTGGGGAAGAAATCAAACATATGCTTTCATTGCCCCCGTAATCCCTTGAAAAAACCTACGAAATGGGGGACGCCCGAAATGCAAATTTTTTCTAATTTCTTCCCGGAATTTTTTTAATTTTAAATAAGAAATAAATCCCAGCCTCACTGGGAGAGCTTCCTCCTTCCCCTCCTAACCAATTTCCTAACATTGGTTGGGAAAAACGTCCCCCTACTTTTTTCAAATAAACAA
Full Trace Sequence: GAAAAGGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTTCATCTTTTACATCTGTGGATTCCTGTGTGTCTGTTTCTTCTGTTTGTGGTTTTTCCTCACCCTCTTCGGCATCAACCTCTTCCACATCTTCAGAATCATCCTGATCATCATCATCTGCAGCAGGCTCTTCCTCTTCTGGCTCTTCATCCACCTGAGCATCAAGGTCAATCTTTAAGCTTAGGCGCAGCATTCTTTCAATCCTGTCTCCATATCCTTTAGTATCAGACAACTGATATCCTGAACGTAGAGTGGCAGTTTCTAAGAGTACGACTGCAAGGTCTGCTACAGTCTGATCGTCTTCGTTTTCCTTTACTCTTCTTAACATATCCTTGATCAAAGGATGTCTTGGATTTATTTCAAATGTCTTCTTCTGGCTTGAATAATAATTTGTGGAAGCATCTTTTCCGGTCTGACAGACCCGCAATTTTCTTGACAATTCAATGAATCAAAACGACCCTTTGCTCACTATTATGCATCGCCGGCGCGATCCAGACAACAGCTGCCCGTGGGGAAGAAATCAAACATATGCTTTCATTGCCCCCGTAATCCCTTGAAAAAACCTACGAAATGGGGGACGCCCGAAATGCAAATTTTTTCTAATTTCTTCCCGGAATTTTTTTAATTTTAAATAAGAAATAAATCCCAGCCTCACTGGGAGAGCTTCCTCCTTCCCCTCCTAACCAATTTCCTAACATTGGTTGGGAAAAACGTCCCCCTACTTTTTTCAAATAAACAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTCATCTTTTACATCTGTGG