ORFeome > hspa14 ORF1 – XORFeome v1.0

hspa14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hspa14
Gene ID: 5932920
Gene Page ID: 5932855
ORF Xenbase ID: 17279757

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141751
Original XGC clone length: 1530

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ838857
dbEST ID: 79656559
Trimmed Sequence: ATGGCGGCTATCGGTGTTCATGACATATTAACAGTGCTGACAATGAAGAGAGATGGATCATTGCACATAACTTGTACTGACAAAGACTCTGGCAAGTCAGAAATGATAACCGTTGAGACTTCTT
Full Trace Sequence: GCGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTATCGGTGTTCATGACATATTAACAGTGCTGACAATGAAGAGAGATGGATCATTGCACATAACTTGTACTGACAAAGACTCTGGCAAGTCAGAAATGATAACCGTTGAGACTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAATGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCCTGACAAAAAACAACAGAAAAATAAAAAGCATGACTACGCAACAGCAGCGAGGAGAGAAATGCCAAAAGTTCGCTGCTACGAAAGGTCGCTGGGTGACACGCGCCGTGTAGACGGATGAGCGCACCAGCCCAGTGGACATAAGCCTGTTCCGTTCTTAAGCTGGAATGTAAGTCGGGTATGCGCTCACGCACCTGATTCAGAACCTTGACCGAACGCAGCGGTGGTAGGGGCGCAGAGGCCTGTTTCATGGCCTGCGGTGGATGTTTTTTTCGAAGTGCCGTCTTTTCCTGCGCGTGGCCAAGCACCGGGTTTGTTAGGGCCATGGGTCGTATGTTTTTTGTATTTACAAACCACAAAGCTCGATTACCACCCGGGCGCCCCAAATTATAAATTAAATTGTAGAAGGGAAGGGAGGAGTCCCGCCACATCGGCCCCACCCCCCCCTGGGAGAGGAGGTTTATACCACTTCCCCGCGCGGCGAGCAGCCGGCGATTGCAGCCGGAAGAGTAATAAATAAAGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTATCGGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838856
dbEST ID: 79656558
Trimmed Sequence: GAAGTCTCAACGGTTATCATTTCTGACTTGCCAGAGTCTTTGTCAGTACAAGTTATGTGCAATGATCCATCTCTCTTCATTGTCAGCACTGTTAATATGTCATGAACACCGATAGCCGCCATGG
Full Trace Sequence: AAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGTCTCAACGGTTATCATTTCTGACTTGCCAGAGTCTTTGTCAGTACAAGTTATGTGCAATGATCCATCTCTCTTCATTGTCAGCACTGTTAATATGTCATGAACACCGATAGCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCCGTCCTTGATAGAAAAAAGATAAAATTACATCATGCCTTGGCAACAGCAAGGCGGAGAGAAAGCAAAAGGCTCAGTGCAAAAAAGGGTGTCGGTTGAAGCGAGAGAGGGCGCGGATGAGAGCCGAAGCCAGGAGAATAAGCATGGATCGGTCGTAAGGTGTTATAGCCGTAGGGTAGGCGCTCACGCAACTGGGCCAGAACCCTGACCGGACGCCGCGGGGGGACCGGGACATTGGCGGGTTTTCTTGGCTGTGGTAACCTGTTTTTTGGGGTACTGTCTAGGCCCTCGAACATCAAACCTCAAGCCGGGGAACCCCCGGGCCGGTGGTTGAACTTGAGGAACAAACACCTTTTTACCCAGCGGGGGCAGTTCTTCCAAAAGAAGGAAGAAATTAGAAAAGGAAGAGTAAAAACCCGGAATATCCACANGNCCTTGANAAGGAGAGGGGGGGGGGTGAGGAGGAAAGGGGGGACCCCGCCNCCANTGGGGGTGGGGGNNTNGAAAAGGAGGNCGGGAGGGAAGAGAAGAAGAGGAAGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAAGTCTCAACGGTTATCATTTC