ORFeome > hspa9 ORF1 – XORFeome v1.0

hspa9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hspa9
Gene ID: 960234
Gene Page ID: 960227
ORF Xenbase ID: 17279793

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045259
Original XGC clone length: 2013

Human orthology & disease relationships

NCBI Entrez ID: 3313
Ensembl gene IDs: ENSG00000113013
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 133239,151623,151660,211980,260500,275355,604929,605280

Library Location

Plate ID: GDExl11008
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ823588
dbEST ID: 79641290
Trimmed Sequence: ATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAAGAAACATTTGATATCTCCCATCCTAAAAATTTCAAAAGG
Full Trace Sequence: CAAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAAGAAACATTTGATATCTCCCATCCTAAAAATTTCAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTGTGCCGGCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ828886
dbEST ID: 79646588
Trimmed Sequence: TTGCTTTTCTTCCTTCTGATCCTCTTTTTGTTGTCCACTTTCAGAGCTGCTTCTTTCAGATGCCATCTTTTTGTAAGCCATTTCAAATAATTTAAGGGAAGCCTGTTGGAGAGTTGATGAAGCATTTCTGATGCTCTCGCCAGTTTCTTCGTCTTTTCGTGCCAAGAGTTCTTTTACCTTGCTGATCTCTTCTTTTAGTTTGTTGCACTCATCAGCTGGCAGCTGATCCTTAAATTCTTCCATTTTTGACTCTGTGTCATGAATAATACCTTCAGCATTGTTTACTGCCTCCACACGCTCCTTTCTTCTTCTATCTTCTTCTGCATACTTTTCTGCATTCTTTACCATATTCTCAATGTCATCCTTGCTTAGTCCGCCAGAAGACTGAATAACAATTTGTTGTTCACGACCTGTTCCTTTGTCTTTTGCCGATACATGAACAATTCCATTTGCATCAATGTCAAAAGTGACTTCAATCTGAGGCACTCCTCGAGGGGCAGGGGGGAAACCAACCAATGTAAACTGGCCAAGAAGTTTGTTGTCACATGCCATTTCTCGCTCTCCTTGGTGAACTTTAATTTCTACTTGTGTCTGGGCATCTGCAGCAGTAGAGAATACCTGGCTTTTCTTTGTTGGTATAGTTGTGTTTCTTCCAATCAGTTTGGTAAAGACTCCTCCAAGTGTTTCAATGCCAAAAAA
Full Trace Sequence: TGACAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGCTTTTCTTCCTTCTGATCCTCTTTTTGTTGTCCACTTTCAGAGCTGCTTCTTTCAGATGCCATCTTTTTGTAAGCCATTTCAAATAATTTAAGGGAAGCCTGTTGGAGAGTTGATGAAGCATTTCTGATGCTCTCGCCAGTTTCTTCGTCTTTTCGTGCCAAGAGTTCTTTTACCTTGCTGATCTCTTCTTTTAGTTTGTTGCACTCATCAGCTGGCAGCTGATCCTTAAATTCTTCCATTTTTGACTCTGTGTCATGAATAATACCTTCAGCATTGTTTACTGCCTCCACACGCTCCTTTCTTCTTCTATCTTCTTCTGCATACTTTTCTGCATTCTTTACCATATTCTCAATGTCATCCTTGCTTAGTCCGCCAGAAGACTGAATAACAATTTGTTGTTCACGACCTGTTCCTTTGTCTTTTGCCGATACATGAACAATTCCATTTGCATCAATGTCAAAAGTGACTTCAATCTGAGGCACTCCTCGAGGGGCAGGGGGGAAACCAACCAATGTAAACTGGCCAAGAAGTTTGTTGTCACATGCCATTTCTCGCTCTCCTTGGTGAACTTTAATTTCTACTTGTGTCTGGGCATCTGCAGCAGTAGAGAATACCTGGCTTTTCTTTGTTGGTATAGTTGTGTTTCTTCCAATCAGTTTGGTAAAGACTCCTCCAAGTGTTTCAATGCCAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGCTTTTCTTCCTTCTGATCCT