ORFeome > hspb1 ORF1 – XORFeome v1.0

hspb1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hspb1
Gene ID: 865364
Gene Page ID: 480319
ORF Xenbase ID: 17279805

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078511
Original XGC clone length: 642

Human orthology & disease relationships

NCBI Entrez ID: 3315
Ensembl gene IDs: ENSG00000106211,LRG_248
Directly associated (OMIM) disease MIM numbers: 606595,608634
Indirectly associated (Lage, et al.) disease MIM numbers: 108120,115200,158590,182290,184500,215600,250100,604219,606595,607841,608634,608810,609285

Library Location

Plate ID: GDExl11005
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ839848
dbEST ID: 79657550
Trimmed Sequence: ATGTCAGAACGCAGAATTCCATTCACCTTCCTCCGCACTCCAAGCTGGGACCCATTTCGGGACTGGTACCAAGGCAGCAGTCGCCTTTTTGATCAGTCATTCGGTATGCCACGTATTCCTGAGGACTGGCACCAATGGCCCAGCACCAGCTGGCCAGGTTATGTTCGCTTGTTTCCGAGCCAATCCATGGACGTTGTACCCCCCACTACACCTGCACCTGCTGGTGCACCTGCTCCTGACTTTAGTCGTGCCCTCAGCCGCCAACTTAGCAGTGGAATCTCAGAGATCCGCCAGACTTCAGACCAATGGAAAATCAGCTTGGATGTCAACCATTTCGCCCCAGAGGAGCTGGTTGTAAAAACTAAAGATGGCATTGTGGAAATAACAGGCAAACATGAAGAGAAACAAGATGAACATGGCTTCATCTCTAGATGCTTCACTAGGAAGTACACTCTTCCTCCAGGTGTTGCAATAAATGCAGTGGCCTCATCGCTTTCTCCTGACGGTATTTTGACTGTCGAGGCCCCACTACCAAAACCTGCCATTCAGTCTGCAGAGATTAGCATCCCAATCACTTTCCAGAGTCGGGCAGAAATTGGCACATCCGAGGCTAAGAGAGGGGAGGAGGCTGGCCAGAGATT
Full Trace Sequence: GGCCCCAAAATAATAGATTTTATATTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGAACGCAGAATTCCATTCACCTTCCTCCGCACTCCAAGCTGGGACCCATTTCGGGACTGGTACCAAGGCAGCAGTCGCCTTTTTGATCAGTCATTCGGTATGCCACGTATTCCTGAGGACTGGCACCAATGGCCCAGCACCAGCTGGCCAGGTTATGTTCGCTTGTTTCCGAGCCAATCCATGGACGTTGTACCCCCCACTACACCTGCACCTGCTGGTGCACCTGCTCCTGACTTTAGTCGTGCCCTCAGCCGCCAACTTAGCAGTGGAATCTCAGAGATCCGCCAGACTTCAGACCAATGGAAAATCAGCTTGGATGTCAACCATTTCGCCCCAGAGGAGCTGGTTGTAAAAACTAAAGATGGCATTGTGGAAATAACAGGCAAACATGAAGAGAAACAAGATGAACATGGCTTCATCTCTAGATGCTTCACTAGGAAGTACACTCTTCCTCCAGGTGTTGCAATAAATGCAGTGGCCTCATCGCTTTCTCCTGACGGTATTTTGACTGTCGAGGCCCCACTACCAAAACCTGCCATTCAGTCTGCAGAGATTAGCATCCCAATCACTTTCCAGAGTCGGGCAGAAATTGGCACATCCGAGGCTAAGAGAGGGGAGGAGGCTGGCCAGAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCAATGCTTATCAATTTGTTGCAACGAACAGGTCACTATCATTCCAAATAAATCATTATTTGCCATCCGGCCTAAAAACCCCCCAAAAAAGAATCATATTAAAAAGGAAAAATAAACGGTTTCCCGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGAACGCAGAATTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839847
dbEST ID: 79657549
Trimmed Sequence: TTTCTTGGCAGCCTCCTCCCCTTTCTTAGCCTCGGATGTGCCAATTTCTGCCCGACTCTGGAAAGTGATTGGGATGCTAATCTCTGCAGACTGAATGGCAGGTTTTGGTAGTGGGGCCTCGACAGTCAAAATACCGTCAGGAGAAAGCGATGAGGCCACTGCATTTATTGCAACACCTGGAGGAAGAGTGTACTTCCTAGTGAAGCATCTAGAGATGAAGCCATGTTCATCTTGTTTCTCTTCATGTTTGCCTGTTATTTCCACAATGCCATCTTTAGTTTTTACAACCAGCTCCTCTGGGGCGAAATGGTTGACATCCAAGCTGATTTTCCATTGGTCTGAAGTCTGGCGGATCTCTGAGATTCCACTGCTAAGTTGGCGGCTGAGGGCACGACTAAAGTCAGGAGCAGGTGCACCAGCAGGTGCAGGTGTAGGTGGGGGGTACAACGTCCATGGATTGGCTCGGAAACAAGCGAACATAACCTGGCCAGCTGGTGCTGGGCCATTGGTGCCAGTCCTCAGGAATACGTGGCATACCGAATGACTGATCAAAAAGGCGACTGCTGCCCTTGGTACCAGTCCCAAAATGGGTCCCACCTTGGAAGTGCGCAGGAAAGTGGATGGGAATTCTCATTCTAAAATGGGTGGCCACTTTTTTTGTACAAAGTTGGCATTAAAAAAAAACAATTGCTTCATCCAATGTGGTGGCAACGAAAAAAG
Full Trace Sequence: GGTGAAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTGGCAGCCTCCTCCCCTTTCTTAGCCTCGGATGTGCCAATTTCTGCCCGACTCTGGAAAGTGATTGGGATGCTAATCTCTGCAGACTGAATGGCAGGTTTTGGTAGTGGGGCCTCGACAGTCAAAATACCGTCAGGAGAAAGCGATGAGGCCACTGCATTTATTGCAACACCTGGAGGAAGAGTGTACTTCCTAGTGAAGCATCTAGAGATGAAGCCATGTTCATCTTGTTTCTCTTCATGTTTGCCTGTTATTTCCACAATGCCATCTTTAGTTTTTACAACCAGCTCCTCTGGGGCGAAATGGTTGACATCCAAGCTGATTTTCCATTGGTCTGAAGTCTGGCGGATCTCTGAGATTCCACTGCTAAGTTGGCGGCTGAGGGCACGACTAAAGTCAGGAGCAGGTGCACCAGCAGGTGCAGGTGTAGGTGGGGGGTACAACGTCCATGGATTGGCTCGGAAACAAGCGAACATAACCTGGCCAGCTGGTGCTGGGCCATTGGTGCCAGTCCTCAGGAATACGTGGCATACCGAATGACTGATCAAAAAGGCGACTGCTGCCCTTGGTACCAGTCCCAAAATGGGTCCCACCTTGGAAGTGCGCAGGAAAGTGGATGGGAATTCTCATTCTAAAATGGGTGGCCACTTTTTTTGTACAAAGTTGGCATTAAAAAAAAACAATTGCTTCATCCAATGTGGTGGCAACGAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTGGCAGCCTCCTCCCCTT