ORFeome > hspb8 ORF1 – XORFeome v1.0

hspb8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hspb8
Gene ID: 945648
Gene Page ID: 945642
ORF Xenbase ID: 17279829

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054225
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID: 26353
Ensembl gene IDs: ENSG00000152137,LRG_249
Directly associated (OMIM) disease MIM numbers: 158590,608673
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,123500,125853,158590,211980,215600,604219,606595,608634

Library Location

Plate ID: GDExl11002
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ839399
dbEST ID: 79657101
Trimmed Sequence: ATGGCTGACAGTCAGTTGCCCTTCACCTGCCATTACCCATCTAACAGACACAGGGGAAGTCGTGATCCTTTTCGGGAACAAGGACTGTCATCTCGTCTTCTTGATGATGATTTTGGCATTCCACCTTTTTCAGATGATTTAACCATGAACTGGCCAGACTGGGTAAGGCCCAGACTGACTTCCTCCTGGTCAGGCCCTTTGAGATCGGGCTTGATGCGAACGTCGGGCATCTCCCCTCCCGTATATAATTTTAGTTACACGGGTAATCCGGAACCTCGTAACACTGTAGCAAATGTCAGCCAACCGTGGAAGGTCTGCGTAAATGTGCAAACTTTCATGCCAGAGGAACTGACAGTTAAAACGAAGGATGGCTTTGTAGAAGTTTCAGGTAACCATGAAGAGCAACAGAAGGAAGGAGGAATTGTCTCTAAAAACTTCACCAAAAAAATTCAGTTGCCTCCAGAAGTGGATGCACTGACTGTTTTTGCCTCGCTGTCTCCTGAAGGCCTTCTTATCATTGAAGCACCTTTGGTGCCTCCCTATAACCAGCAGGGAGATGATAGTTACACATATGAGCTGCCTCCAGATCCTTAAGAAGTCTGTGCTTCCTT
Full Trace Sequence: GGCGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGACAGTCAGTTGCCCTTCACCTGCCATTACCCATCTAACAGACACAGGGGAAGTCGTGATCCTTTTCGGGAACAAGGACTGTCATCTCGTCTTCTTGATGATGATTTTGGCATTCCACCTTTTTCAGATGATTTAACCATGAACTGGCCAGACTGGGTAAGGCCCAGACTGACTTCCTCCTGGTCAGGCCCTTTGAGATCGGGCTTGATGCGAACGTCGGGCATCTCCCCTCCCGTATATAATTTTAGTTACACGGGTAATCCGGAACCTCGTAACACTGTAGCAAATGTCAGCCAACCGTGGAAGGTCTGCGTAAATGTGCAAACTTTCATGCCAGAGGAACTGACAGTTAAAACGAAGGATGGCTTTGTAGAAGTTTCAGGTAACCATGAAGAGCAACAGAAGGAAGGAGGAATTGTCTCTAAAAACTTCACCAAAAAAATTCAGTTGCCTCCAGAAGTGGATGCACTGACTGTTTTTGCCTCGCTGTCTCCTGAAGGCCTTCTTATCATTGAAGCACCTTTGGTGCCTCCCTATAACCAGCAGGGAGATGATAGTTACACATATGAGCTGCCTCCAGATCCTTAAGAAGTCTGTGCTTCCTTGCCAACTTTCTTGGACAAAGTTGGCCATTATAAGAAAGCATTGCTTATCAATTTGTTGCCACGAACAGGTCACTAATCATCAAAATAAAATCATTATTTTGCCATCCCAGCTGAATTTCCCCAATAAGGGAGTCGTTATATAAAGGGAAAAAAAAAATATTCCCCCGGGCAACCTCTTGGGCCCGCGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGACAGTCAGTTGCCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839398
dbEST ID: 79657100
Trimmed Sequence: GGAAGCACAGACTTCTTGAGGATCTAGAGGCAGCTCATATGTGTAACTATCATCTCCCTGCTGGTTATAGGGAGGCACCAAAGGTGCTTCAATGATAAGAAGGCCTTCAGGAGACAGCGAGGCAAAAACAGTCAGTGCATCCACTTCTGGAGGCAACTGAATTTTTTTGGTGAAGTTTTTAGAGACAATTCCTCCTTCCTTCTGTTGCTCTTCATGGTTACCTGAAACTTCTACAAAGCCATCCTTCGTTTTAACTGTCAGTTCCTCTGGCATGAAAGTTTGCACATTTACGCAGACCTTCCACGGTTGGCTGACATTTGCTACAGTGTTACGAGGTTCCGGATTACCCGTGTAACTAAAATTATATACGGGAGGGGAGATGCCCGACGTTCGCATCAAGCCCGATCTCAAAGGGCCTGACCAGGAGGAAGTCAGTCTGGGCCTTACCCAGTCTGGCCAGTTCATGGTTAAATCATCTGAAAAAGGTGGAATGCCAAAATCATCATCAAGAAAACGAGATGACAGTCCTTGTTCCCCAAAAGGATCACGACTTCCCCTGTGTCTGTTAAATGGGTTATGGCCGGGTGAAGGGCAACTGACTGTCAACCATGTTGCCCAACTTTTTTTTACAAGTTTGCATTATTAAAAACCTTTGCTCATCCATTTGTTGGCAACCAACAAAGAAAAAAAAAAAATAAAAAAAAAAATAAATTAATTTGCGGGCCCGAAGCTTTAAAAACTGGGCCCTTCCTTTTTAAAA
Full Trace Sequence: CGAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAAGCACAGACTTCTTGAGGATCTAGAGGCAGCTCATATGTGTAACTATCATCTCCCTGCTGGTTATAGGGAGGCACCAAAGGTGCTTCAATGATAAGAAGGCCTTCAGGAGACAGCGAGGCAAAAACAGTCAGTGCATCCACTTCTGGAGGCAACTGAATTTTTTTGGTGAAGTTTTTAGAGACAATTCCTCCTTCCTTCTGTTGCTCTTCATGGTTACCTGAAACTTCTACAAAGCCATCCTTCGTTTTAACTGTCAGTTCCTCTGGCATGAAAGTTTGCACATTTACGCAGACCTTCCACGGTTGGCTGACATTTGCTACAGTGTTACGAGGTTCCGGATTACCCGTGTAACTAAAATTATATACGGGAGGGGAGATGCCCGACGTTCGCATCAAGCCCGATCTCAAAGGGCCTGACCAGGAGGAAGTCAGTCTGGGCCTTACCCAGTCTGGCCAGTTCATGGTTAAATCATCTGAAAAAGGTGGAATGCCAAAATCATCATCAAGAAAACGAGATGACAGTCCTTGTTCCCCAAAAGGATCACGACTTCCCCTGTGTCTGTTAAATGGGTTATGGCCGGGTGAAGGGCAACTGACTGTCAACCATGTTGCCCAACTTTTTTTTACAAGTTTGCATTATTAAAAACCTTTGCTCATCCATTTGTTGGCAACCAACAAAGAAAAAAAAAAAATAAAAAAAAAAATAAATTAATTTGCGGGCCCGAAGCTTTAAAAACTGGGCCCTTCCTTTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAGCACAGACTTCTTGAGG