ORFeome > hspbp1 ORF1 – XORFeome v1.0

hspbp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hspbp1
Gene ID: 1007210
Gene Page ID: 1007204
ORF Xenbase ID: 17279841

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124886
Original XGC clone length: 978

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ838813
dbEST ID: 79656515
Trimmed Sequence: ATGGCTGACGGGGGACAAGATGGGAACAGACCACACCAACAAAATCTGCAGGGCCTACTTCATATGGCCATTGAAGCTGGAACCATGTCTGACTCTGCTCCCCAAACGGAGCCAATGTCAGAGGAGAGGAGGCAGTGGCTCCAGCAAGCCATGAATAGTGCTTTTTCTGGCCAAGTTGATGAGGTGAAGATAATGAAGGAATGCCTGAAAGAGTTAAGTAATGAAACACACAATGGCGATGAAGAAGATGCCAAAGAGCAGGCGCTGGAGCTGCTGGCTGATTTGTGTGATAATCTAGACAATGCCTCAGATTTCTGCAAACTGGGTGGCATGAACCTGCTACTTTCTCGTTACGTCAACTGCCCCCAAGCAGAACTGCGCTGGAGATCGGCCGACCTGATTGGCATATGCAGCCAGAATGTACCATTTGTTCAGGAGACGGCACTTCGCTTGGGAGCAGTGAAGATTCTTTTACAACTTCTGGACCTTGACTCTGATGATCAAGTCAGGATAAAAGGCCCTTTTTGCTATTTCTTGCTTGGTACGGGAACAAGAAAAAGGACTTGCTGAGTTCCCGAAACAAGAATGCTTCTCTGTGTTAATGCGAACCATGGAAAGGTGATGCGCGGAGACCTAAAGGATAAAATCTGCCTTCCTTGCTGGCGAAGGGTTTTAATAAATTTCCACAAAAGACCAAAGGAACCTTTAAGGATCTATTGATTAATGGGTGAAAGGGGGGGGGGTGTGTCTCCTGCG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGACGGGGGACAAGATGGGAACAGACCACACCAACAAAATCTGCAGGGCCTACTTCATATGGCCATTGAAGCTGGAACCATGTCTGACTCTGCTCCCCAAACGGAGCCAATGTCAGAGGAGAGGAGGCAGTGGCTCCAGCAAGCCATGAATAGTGCTTTTTCTGGCCAAGTTGATGAGGTGAAGATAATGAAGGAATGCCTGAAAGAGTTAAGTAATGAAACACACAATGGCGATGAAGAAGATGCCAAAGAGCAGGCGCTGGAGCTGCTGGCTGATTTGTGTGATAATCTAGACAATGCCTCAGATTTCTGCAAACTGGGTGGCATGAACCTGCTACTTTCTCGTTACGTCAACTGCCCCCAAGCAGAACTGCGCTGGAGATCGGCCGACCTGATTGGCATATGCAGCCAGAATGTACCATTTGTTCAGGAGACGGCACTTCGCTTGGGAGCAGTGAAGATTCTTTTACAACTTCTGGACCTTGACTCTGATGATCAAGTCAGGATAAAAGGCCCTTTTTGCTATTTCTTGCTTGGTACGGGAACAAGAAAAAGGACTTGCTGAGTTCCCGAAACAAGAATGCTTCTCTGTGTTAATGCGAACCATGGAAAGGTGATGCGCGGAGACCTAAAGGATAAAATCTGCCTTCCTTGCTGGCGAAGGGTTTTAATAAATTTCCACAAAAGACCAAAGGAACCTTTAAGGATCTATTGATTAATGGGTGAAAGGGGGGGGGGTGTGTCTCCTGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGACGGGGGACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838812
dbEST ID: 79656514
Trimmed Sequence: TCTATCCATACTACGGTCTTCTGGAGTTTTCTGAAAGCAGATTTGTAGAAGACTCTTGCAGTACTCCAGCTCTTCCTGAAACTCTTCTTTTTTCTCTAGCAGCTGACATCGTTCTTTGAGAAGATCTTCAAATGCTAGTTCTGGGACCCGACACTCAGACACCGCTTGTGGGAAATCGGTCACAAAACTGCAGAGGGCACCCAACACATGTTCATGGAAAGGGCTATGATCAGTGTGTAGCAGAGATACCAGCTGCTGTACCATACCCATAGAGCATAAGGTTCCTTTGTGTTCTGGGTGACTTATTAAAAGGTTCTGCAGCAGGAAGGCAGATTTGACCTTTAGTTTCTGAGCATCACTTTGCATGGCTCGCATTAACACAGAGAAGCCATCTTGCTTCAGGAACTCAGCAAGTCCTTCTTCTTGCTCCCGTACCAAGCAAGAAATAGCAAAAAGGGCCTTTATCCTGACTTGATCATTAGAGTCAAGGTCCAGAAGTTGTAGAAGAATCTTCACTGCTCCCAAGCGAAGTGCCGTCTCCTGAACAAATGGTACATTCTGGCTGCATATGCCAATCAGGTCGGCCGATCTCCAGCGCAGTTCTGCTTGGGGGGCAGTTGACGTAAAGAGAAAGTAACAGGTTCAATGCCCCCCATTTTGCAAAAATCTGAAGCATTTGTCTAGAATATTCAGACAAATCAACCCGGAACCTTCCCGCGCCCGGCTCTTTTTGGCAGTCTTCCTTCCCTCCGCCCATTTGGTG
Full Trace Sequence: AAGACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTATCCATACTACGGTCTTCTGGAGTTTTCTGAAAGCAGATTTGTAGAAGACTCTTGCAGTACTCCAGCTCTTCCTGAAACTCTTCTTTTTTCTCTAGCAGCTGACATCGTTCTTTGAGAAGATCTTCAAATGCTAGTTCTGGGACCCGACACTCAGACACCGCTTGTGGGAAATCGGTCACAAAACTGCAGAGGGCACCCAACACATGTTCATGGAAAGGGCTATGATCAGTGTGTAGCAGAGATACCAGCTGCTGTACCATACCCATAGAGCATAAGGTTCCTTTGTGTTCTGGGTGACTTATTAAAAGGTTCTGCAGCAGGAAGGCAGATTTGACCTTTAGTTTCTGAGCATCACTTTGCATGGCTCGCATTAACACAGAGAAGCCATCTTGCTTCAGGAACTCAGCAAGTCCTTCTTCTTGCTCCCGTACCAAGCAAGAAATAGCAAAAAGGGCCTTTATCCTGACTTGATCATTAGAGTCAAGGTCCAGAAGTTGTAGAAGAATCTTCACTGCTCCCAAGCGAAGTGCCGTCTCCTGAACAAATGGTACATTCTGGCTGCATATGCCAATCAGGTCGGCCGATCTCCAGCGCAGTTCTGCTTGGGGGGCAGTTGACGTAAAGAGAAAGTAACAGGTTCAATGCCCCCCATTTTGCAAAAATCTGAAGCATTTGTCTAGAATATTCAGACAAATCAACCCGGAACCTTCCCGCGCCCGGCTCTTTTTGGCAGTCTTCCTTCCCTCCGCCCATTTGGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTATCCATACTACGGTCTTCT