ORFeome > htatip2 ORF1 – XORFeome v1.0

htatip2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: htatip2
Gene ID: 6255886
Gene Page ID: 946973
ORF Xenbase ID: 17279871

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097780
Original XGC clone length: 720

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ838449
dbEST ID: 79656151
Trimmed Sequence: ATGGATAAAGATATTGAGGTCTTGCGGGAGGATTACAGGAAAATGAACAAGTCTTGCTTCATCCTCGGGGCCTCGGGGGAGACAGGGAAGGAGCTGCTGAAAGAGATCGTCACGAGCAGACTGTTCAGTCGAGTTACGCTCATCGGGCGCAGGAAACTGACTTTGGAAGATGAGGCCTATAAAGAGGTGGCACAAGAGGTGGTGGATTTCGAGAAGTTAGACGAATTCTCCGCCGCTTTCCAAGGCCACGATGTCGGATTCTGCTGTTTGGGGACGACCAAGGCCAAAGCTGGGCAGGCCGGATTTATCCGCGTGGATCACGACTATGTCCTGAAGTCGGCCGAGTTGGCCAAGGCCGGGGGCTGCTCCCACTTCAACCTGGAATCATCCAAAGGGGCAGATAAGAGCAGCAGTTTCCTCTACCTGAAGGTTAAGGGGGAAGTTGAAGCAGAAGTACAGGAGCTGGGCTTTGAGCGCTACACGATCTTCAGACCGGCGGTCCTACTGTGCGACCGGCAGGAGTCTCGCCCCTCAAAATGGTTTGCCAGGAAAATGCTTGTGCCCGTTTCCTACATGTTCCCCACCGCTTACTCTGTGCCCATCACAACACTGGTTATAGCCATGGTGAACAACGCGGTGCTGCCGGGAGATAAAAAGGTGGAATTACTGGAAAACAAGGCCATTCACT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATAAAGATATTGAGGTCTTGCGGGAGGATTACAGGAAAATGAACAAGTCTTGCTTCATCCTCGGGGCCTCGGGGGAGACAGGGAAGGAGCTGCTGAAAGAGATCGTCACGAGCAGACTGTTCAGTCGAGTTACGCTCATCGGGCGCAGGAAACTGACTTTGGAAGATGAGGCCTATAAAGAGGTGGCACAAGAGGTGGTGGATTTCGAGAAGTTAGACGAATTCTCCGCCGCTTTCCAAGGCCACGATGTCGGATTCTGCTGTTTGGGGACGACCAAGGCCAAAGCTGGGCAGGCCGGATTTATCCGCGTGGATCACGACTATGTCCTGAAGTCGGCCGAGTTGGCCAAGGCCGGGGGCTGCTCCCACTTCAACCTGGAATCATCCAAAGGGGCAGATAAGAGCAGCAGTTTCCTCTACCTGAAGGTTAAGGGGGAAGTTGAAGCAGAAGTACAGGAGCTGGGCTTTGAGCGCTACACGATCTTCAGACCGGCGGTCCTACTGTGCGACCGGCAGGAGTCTCGCCCCTCAAAATGGTTTGCCAGGAAAATGCTTGTGCCCGTTTCCTACATGTTCCCCACCGCTTACTCTGTGCCCATCACAACACTGGTTATAGCCATGGTGAACAACGCGGTGCTGCCGGGAGATAAAAAGGTGGAATTACTGGAAAACAAGGCCATTCACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAAAGATATTGAGGTCTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838448
dbEST ID: 79656150
Trimmed Sequence: CTTCTTCGCTTCTCCCAGTTTCCCCAGAGAGTGAATTGCCTTGTTTTCCAGTAATTCCACCTTTTTATCTCCCGGCAGCACCGCGTTGTTCACCATGGCTTTTACCAGTGTTGTGATGGGCACAGAGTAAGCGGTGGGGAACATGTAGGAAACGGGCACAAGCATTTTCCTGGCAAACCATTCTGAGGGGCGAGACTCCTGCCGGTCGCACAGTAGGACCGCCGGTCTGAAGATCGTGTAGCGCTCAAAGCCCAGCTCCTGTACTTCTGCTTCAACTTCCCCCTTAACCTTCAGGTAGAGGAAACTGCTGCTCTTATCTGCCCCTTTGGATGATTCCAGGTTGAAGTGGGAGCAGCCCCCGGCCTTGGCCAACTCGGCCGACTTCAGGACATAGTCGTGATCCACGCGGATAAATCCGGCCTGCCCAGCTTTGGCCTTGGTCGTCCCCAAACAGCAGAATCCGACATCGTGGCCTTGGAAAGCGGCGGAGAATTCGTCTAACTTCTCCAAATCCACCACCTCTTGTGCCACCTCTTTATAGGCCTCCATCTTCCAAATCAGTTTCCTGCCCCCGATAAGCCGAACTCAAATGAAAAGTCTGCTCCTTACCATCGCCTTCAACAACTCCTTTCCTGTTCTCTCTCAAGCCCCAAAGAAGAAGCC
Full Trace Sequence: CGGGAATCAGCTATGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTTCGCTTCTCCCAGTTTCCCCAGAGAGTGAATTGCCTTGTTTTCCAGTAATTCCACCTTTTTATCTCCCGGCAGCACCGCGTTGTTCACCATGGCTTTTACCAGTGTTGTGATGGGCACAGAGTAAGCGGTGGGGAACATGTAGGAAACGGGCACAAGCATTTTCCTGGCAAACCATTCTGAGGGGCGAGACTCCTGCCGGTCGCACAGTAGGACCGCCGGTCTGAAGATCGTGTAGCGCTCAAAGCCCAGCTCCTGTACTTCTGCTTCAACTTCCCCCTTAACCTTCAGGTAGAGGAAACTGCTGCTCTTATCTGCCCCTTTGGATGATTCCAGGTTGAAGTGGGAGCAGCCCCCGGCCTTGGCCAACTCGGCCGACTTCAGGACATAGTCGTGATCCACGCGGATAAATCCGGCCTGCCCAGCTTTGGCCTTGGTCGTCCCCAAACAGCAGAATCCGACATCGTGGCCTTGGAAAGCGGCGGAGAATTCGTCTAACTTCTCCAAATCCACCACCTCTTGTGCCACCTCTTTATAGGCCTCCATCTTCCAAATCAGTTTCCTGCCCCCGATAAGCCGAACTCAAATGAAAAGTCTGCTCCTTACCATCGCCTTCAACAACTCCTTTCCTGTTCTCTCTCAAGCCCCAAAGAAGAAGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTCGCTTCTCCCAGT