ORFeome > hypk ORF1 – XORFeome v1.0

hypk ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hypk
Gene ID: 999056
Gene Page ID: 999051
ORF Xenbase ID: 17279919

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078471
Original XGC clone length: 366

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ839810
dbEST ID: 79657512
Trimmed Sequence: ATGGCGGCTGAAGGGGATGTTGAGTTAGAGCTGGAGACTGAAGACAACTGCAGCGAGCGTCCTGCCGATAAACCACGTAAACATGACAGCGGGGCGGCTGATCTGGAGAGGGTGACAGACTATGCCGAAGAGAAAGAGATTCAGAGCTCCAACCTGGAGACGGCCATGTCAGTGATTGGAGACAGAAGATCAAGAGAACAGAAAGCAAAACAGGAGAGAGAAAAGGAACTGGCCAAAGTAACAATCAAGAAAGAAGATGTGGAGCTTATTATGAATGAAATGGAAATTCCACGATCAGCAGCAGAAAGAAGCTTGAGGGAACACATGGGGAATGTAGTAGAGGCACTGATTGCTTTGACCAACTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGAAGGGGATGTTGAGTTAGAGCTGGAGACTGAAGACAACTGCAGCGAGCGTCCTGCCGATAAACCACGTAAACATGACAGCGGGGCGGCTGATCTGGAGAGGGTGACAGACTATGCCGAAGAGAAAGAGATTCAGAGCTCCAACCTGGAGACGGCCATGTCAGTGATTGGAGACAGAAGATCAAGAGAACAGAAAGCAAAACAGGAGAGAGAAAAGGAACTGGCCAAAGTAACAATCAAGAAAGAAGATGTGGAGCTTATTATGAATGAAATGGAAATTCCACGATCAGCAGCAGAAAGAAGCTTGAGGGAACACATGGGGAATGTAGTAGAGGCACTGATTGCTTTGACCAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAAAAAAAAAAATAACATAAAAAAAACCCCACCCAACAAAAACCCCAGGAAAAAAAAAAAAAAAAAAAGATCCTAAAAAAAAGTGGCCGGGTGGTGGGGGTGTGGTGGGGGGGGGGAGAAAGCCCCCCCCAGAAAAAAGCCCCCCGGCGGGGGGGTGAGGGGTTGGTGTTGCAAGCAGGGGCAGGGGGGGGCGGGGGCGGCCCCAACCCTTCCCGCAAACACAAACCGGGGGGGTGGGGGGGGGGGAGTGATGTTTTTTTTTTTTTTTTTATGTTTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGAAGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839809
dbEST ID: 79657511
Trimmed Sequence: GTTGGTCAAAGCAATCAGTGCCTCTACTACATTCCCCATGTGTTCCCTCAAGCTTCTTTCTGCTGCTGATCGTGGAATTTCCATTTCATTCATAATAAGCTCCACATCTTCTTTCTTGATTGTTACTTTGGCCAGTTCCTTTTCTCTCTCCTGTTTTGCTTTCTGTTCTCTTGATCTTCTGTCTCCAATCACTGACATGGCCGTCTCCAGGTTGGAGCTCTGAATCTCTTTCTCTTCGGCATAGTCTGTCACCCTCTCCAGATCAGCCGCCCCGCTGTCATGTTTACGTGGTTTATCGGCAGGACGCTCGCTGCAGTTGTCTTCAGTCTCCAGCTCTAACTCAACATCCCCTTCAGCCGCCATGG
Full Trace Sequence: GTGAAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGTCAAAGCAATCAGTGCCTCTACTACATTCCCCATGTGTTCCCTCAAGCTTCTTTCTGCTGCTGATCGTGGAATTTCCATTTCATTCATAATAAGCTCCACATCTTCTTTCTTGATTGTTACTTTGGCCAGTTCCTTTTCTCTCTCCTGTTTTGCTTTCTGTTCTCTTGATCTTCTGTCTCCAATCACTGACATGGCCGTCTCCAGGTTGGAGCTCTGAATCTCTTTCTCTTCGGCATAGTCTGTCACCCTCTCCAGATCAGCCGCCCCGCTGTCATGTTTACGTGGTTTATCGGCAGGACGCTCGCTGCAGTTGTCTTCAGTCTCCAGCTCTAACTCAACATCCCCTTCAGCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGACCAAAAAATACAACAAAAATAAACTGAGCTCCTCCCGACAGCTCTCGGCCAGAACAAAAAAAACAAAAACAAAAAAAAAATGGCGGCGTTTTCACTGGATATAAGGAGGAGCGCGGCGCCCCCACAAAAAAACACCCGCGGGCGCGGTAATGGATATGGTACGTGCGCGCCTGGTTGGGGGGGGGTGAAAAACANAACACACNCGAGGGGGAAAAAGACAGGCCGCTGCTGGGAGTTTTATTTAGTTTTTTTTGGTTGGTGAATCTCATCCTGCTTGTTGCGGCTGCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGTCAAAGCAATCAGTGCCTC