ORFeome > id3 ORF2 – XORFeome v1.0

id3 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: id3
Gene ID: 6256366
Gene Page ID: 495260
ORF Xenbase ID: 17279967

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044039
Original XGC clone length: 357

Human orthology & disease relationships

NCBI Entrez ID: 3399
Ensembl gene IDs: ENSG00000117318
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101400,180750

Library Location

Plate ID: GDExl11017
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ824346
dbEST ID: 79642048
Trimmed Sequence: ATGAAAGCCATCAGCCCAGTGCGGTCCATGTCAAGCTGCTACCAGGCTGTCTGCTGCTTGTCCGAGCAGAGTCTGAGCATTGCCAGGGGCAGTAGCCACAAGGGACCAGGTATGGATGAGCCAATGGGGCTCCTGTACGATATGAACGGCTGCTACTCCAAGCTGAAAGAGTTGGTGCCAGGGATCCCCCAGGGAAGCAAGCTCAGCCAAGTGGAGATCCTGCAGCATGTCATCGACTACATCTTCGACCTGCAGATAGTCCTGGGGGAAGATCAACAACAAAGCAGCATTCTTAGCCTTCAGAAATCCGATTTCTCAGAATTGGCAACACAAGGGGACACCAGCGTCTGCCACTT
Full Trace Sequence: GGCAGTGATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAAGCCATCAGCCCAGTGCGGTCCATGTCAAGCTGCTACCAGGCTGTCTGCTGCTTGTCCGAGCAGAGTCTGAGCATTGCCAGGGGCAGTAGCCACAAGGGACCAGGTATGGATGAGCCAATGGGGCTCCTGTACGATATGAACGGCTGCTACTCCAAGCTGAAAGAGTTGGTGCCAGGGATCCCCCAGGGAAGCAAGCTCAGCCAAGTGGAGATCCTGCAGCATGTCATCGACTACATCTTCGACCTGCAGATAGTCCTGGGGGAAGATCAACAACAAAGCAGCATTCTTAGCCTTCAGAAATCCGATTTCTCAGAATTGGCAACACAAGGGGACACCAGCGTCTGCCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTAAACAATAAAATAATTTAAAAGTTTGGGGTTTTTGTGCGGTCTTTTTGGCGGTTGGCTGACATCGTCCACTTCTTGGGCGATTAACGTAAACAAGCGCGCTGGCCATATCCGTGGGCAGCATGAGCCCAGCTTACCTGCCCGATATGAACTCAACGGGTAAAATTCACCCGAAGAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAGCCATCAGCCCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829705
dbEST ID: 79647407
Trimmed Sequence: GTGGCAGACGCTGGTGTCCCCTTGTGTTGCCAATTCTGAGAAATCGGATTTCTGAAGGCTAAGAATGCTGCTTTGTTGTTGATCTTCCCCCAGGACTATCTGCAGGTCGAAGATGTAGTCGATGACATGCTGCAGGATCTCCACTTGGCTGAGCTTGCTTCCCTGGGGGATCCCTGGCACCAACTCTTTCAGCTTGGAGTAGCAGCCGTTCATATCGTACAGGAGCCCCATTGGCTCATCCATACCTGGTCCCTTGTGGCTACTGCCCCTGGCAATGCTCAGACTCTGCTCGGACAAGCAGCAGACAGCCTGGTAGCAGCTTGACATGGACCGCACTGGGCTGATGGCTTTCATGG
Full Trace Sequence: CTGGTCGGGAACAGCCACTGGAGCTGGACAAACGAACGCCACTCGAGGGGAGCAGCAGCCGGGAAGGGGCCAAAAGAAAGCGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGCAGACGCTGGTGTCCCCTTGTGTTGCCAATTCTGAGAAATCGGATTTCTGAAGGCTAAGAATGCTGCTTTGTTGTTGATCTTCCCCCAGGACTATCTGCAGGTCGAAGATGTAGTCGATGACATGCTGCAGGATCTCCACTTGGCTGAGCTTGCTTCCCTGGGGGATCCCTGGCACCAACTCTTTCAGCTTGGAGTAGCAGCCGTTCATATCGTACAGGAGCCCCATTGGCTCATCCATACCTGGTCCCTTGTGGCTACTGCCCCTGGCAATGCTCAGACTCTGCTCGGACAAGCAGCAGACAGCCTGGTAGCAGCTTGACATGGACCGCACTGGGCTGATGGCTTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGGGGCCCAAGCTAAAAACTGGCCGTCGTTTTACACGGAGTGTAACTTGGGAATTTTTCAAAGGAAGCTAAGTCTCGATGCAGCACAAGTGTTGATCATAGCCACTATTCAAATTCCTTGCCCCGCGTGAATGAACGGCTCATTCGGGAATTCGTTACTGCCCAGTTACGCACCGGTGACGCTGGTGGATATGGGTTGTCGTTGTTTCACCTTTTGGTTTAACCCTATTATTCCGATGAAGGGAAACCTTGCAAACGTTTTTTGCACCCGTTTCTTGGGGTTGTGAAATTCCAGAGGGCACAAATGTTTTCCGGTTCAGTCTTTTTCATTGACAACTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCAGACGCTGGTGT