ORFeome > idh2 ORF1 – XORFeome v1.0

idh2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: idh2
Gene ID: 976321
Gene Page ID: 976314
ORF Xenbase ID: 17279985

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054241
Original XGC clone length: 1365

Human orthology & disease relationships

NCBI Entrez ID: 3418
Ensembl gene IDs: ENSG00000182054
Directly associated (OMIM) disease MIM numbers: 613657
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ839574
dbEST ID: 79657276
Trimmed Sequence: ATGGCAGGTTATCTGCGTGCTGTTAGTTCCCTCTGCAGAGCATCCGCCACCGCCTTGGGCAAGAACCCTGGTGTGCTCGCCCCGGCCCTCAGCCAACAGCTGCAGCAACAACGAAACTATGCTGATAAACGTATCAAGGTGGCCAATCCGGTTGTGGAGATGGATGGTGATGAGATGACCCGTATCATCTGGGAATTTATAAAGGAGAAGTTGATCCTGTCCAATGTAGATGTTGAGCTGAAATACTTTGATCTTGGTCTTCCATACCGTGACCAAACAGATGACCAGGTCACCATAGACTCTGCACTAGCCACTCTGAAATACAATGTTGCTGTGAAATGTGCTACTATTACCCCTGATGAGGCAAGAGTTGAAGAGTTTAAGCTAAAAAAGATGTGGAAGAGTCCCAATGGTACAGTCAGGAACATATTGGGCGGAACAGTATTCCGTGAGCCAATTATTTGCAAGAATATTCCTCGTCTGGTACCTGGCTGGACACAAGCCATTACCATTGGCAGACATGCCCACGGCGATCAGTACAAAGCTACAGACTTCGTGGTTGATCAGGCTGGAACTTTCAAAATGGTCTTTACCCCAGCAAATGGGACTGCCACAAAGGAATGGGAAGTGTTTAATTTTCCTGCTTGAGGTGTTGGCATGGGCATGTACAACACAAATGATTCAATCTCTGGATTTGCTCACAGCTGCTTTCAGTATGCCATACAAAAAAAAATTGGCCCCTGTATATTAAACCCAAAGAAAACCCCTTTTTAAAAGCCCTTATAAAGGGGCAGGGTTTTAAGGGAACATCTTTC
Full Trace Sequence: CGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGTTATCTGCGTGCTGTTAGTTCCCTCTGCAGAGCATCCGCCACCGCCTTGGGCAAGAACCCTGGTGTGCTCGCCCCGGCCCTCAGCCAACAGCTGCAGCAACAACGAAACTATGCTGATAAACGTATCAAGGTGGCCAATCCGGTTGTGGAGATGGATGGTGATGAGATGACCCGTATCATCTGGGAATTTATAAAGGAGAAGTTGATCCTGTCCAATGTAGATGTTGAGCTGAAATACTTTGATCTTGGTCTTCCATACCGTGACCAAACAGATGACCAGGTCACCATAGACTCTGCACTAGCCACTCTGAAATACAATGTTGCTGTGAAATGTGCTACTATTACCCCTGATGAGGCAAGAGTTGAAGAGTTTAAGCTAAAAAAGATGTGGAAGAGTCCCAATGGTACAGTCAGGAACATATTGGGCGGAACAGTATTCCGTGAGCCAATTATTTGCAAGAATATTCCTCGTCTGGTACCTGGCTGGACACAAGCCATTACCATTGGCAGACATGCCCACGGCGATCAGTACAAAGCTACAGACTTCGTGGTTGATCAGGCTGGAACTTTCAAAATGGTCTTTACCCCAGCAAATGGGACTGCCACAAAGGAATGGGAAGTGTTTAATTTTCCTGCTTGAGGTGTTGGCATGGGCATGTACAACACAAATGATTCAATCTCTGGATTTGCTCACAGCTGCTTTCAGTATGCCATACAAAAAAAAATTGGCCCCTGTATATTAAACCCAAAGAAAACCCCTTTTTAAAAGCCCTTATAAAGGGGCAGGGTTTTAAGGGAACATCTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGTTATCTGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839573
dbEST ID: 79657275
Trimmed Sequence: ATTCTTTCCAAGTGCTTTATCGAGGTTGTTCTTGATGGCATCCAAAAAGTCTGTTGTGTTTACATAATGTTCATTAAGACGAACGTTGCTCATGCCTCCATGAATACAGCCAGCCAAGTCTTTTGTCATGATGCCACTTTCCACAGTCTCCACACAAACCTTTTCAAGTTTTAAAGAGAAGTTTATTAGGTCCTGGTTTCCGTCTAGCTTGCCTCTGTGTTCCAAGCCTCTTGTCCAAGCAAAAATACTGGCAATTGGGTTAGTGCTTGTTGGCCTTCCCTTTTGATGTTCCCTATAATGGCGAGTGACTGTTCCATGAGCTGCTTCAGCTTCAATTGTCTTTCCATCTGGGCAAACCAGGACTGAGGACATTAAACCAAGAGAACCAAAGCCTTGAGCAAGAATATCTGACTGAACATCTCCATCATAGTTCTTGCAAGCCCAAACAAAGCCTCCAGAAGACTTCAGAACCTGTGCAACCATATCATCAATTAATCGGTGTTCATACCAAATCTTCACTTTGTCAAAATCTGGCTTGTAATGCTTTTCAAAGATGTCCTGGGAAGATGTCCTTAAACCTGCCATCATAGGCCTTTAAAATGGTGTTCTTTGTGCTCATATACGGGGGCCACTTCTTCTGTATGGCATACTGGAAGCAGCTGTGAGCAAATCCCGAGACCCAATCCTCCTGTGTTGTACATGCCCAATGCCCACCACCTCCCCCAGGAAACCTAAAACCCCTTCCCCATTCCCTTTTGTTGGCAACCCCAAAT
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTTTCCAAGTGCTTTATCGAGGTTGTTCTTGATGGCATCCAAAAAGTCTGTTGTGTTTACATAATGTTCATTAAGACGAACGTTGCTCATGCCTCCATGAATACAGCCAGCCAAGTCTTTTGTCATGATGCCACTTTCCACAGTCTCCACACAAACCTTTTCAAGTTTTAAAGAGAAGTTTATTAGGTCCTGGTTTCCGTCTAGCTTGCCTCTGTGTTCCAAGCCTCTTGTCCAAGCAAAAATACTGGCAATTGGGTTAGTGCTTGTTGGCCTTCCCTTTTGATGTTCCCTATAATGGCGAGTGACTGTTCCATGAGCTGCTTCAGCTTCAATTGTCTTTCCATCTGGGCAAACCAGGACTGAGGACATTAAACCAAGAGAACCAAAGCCTTGAGCAAGAATATCTGACTGAACATCTCCATCATAGTTCTTGCAAGCCCAAACAAAGCCTCCAGAAGACTTCAGAACCTGTGCAACCATATCATCAATTAATCGGTGTTCATACCAAATCTTCACTTTGTCAAAATCTGGCTTGTAATGCTTTTCAAAGATGTCCTGGGAAGATGTCCTTAAACCTGCCATCATAGGCCTTTAAAATGGTGTTCTTTGTGCTCATATACGGGGGCCACTTCTTCTGTATGGCATACTGGAAGCAGCTGTGAGCAAATCCCGAGACCCAATCCTCCTGTGTTGTACATGCCCAATGCCCACCACCTCCCCCAGGAAACCTAAAACCCCTTCCCCATTCCCTTTTGTTGGCAACCCCAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTTTCCAAGTGCTTTATCGAG