ORFeome > ido1 ORF1 – XORFeome v1.0

ido1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ido1
Gene ID: 866126
Gene Page ID: 492114
ORF Xenbase ID: 17280009

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128934
Original XGC clone length: 1197

Human orthology & disease relationships

NCBI Entrez ID: 3620
Ensembl gene IDs: ENSG00000131203
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 235800,608516,608643

Library Location

Plate ID: GDExl11085
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ837844
dbEST ID: 79655546
Trimmed Sequence: ATGGAGAATCAAGATATTAATCCCAAGGAGTTCTATGTGTCTGAACAATATGGATTTATTCTCCAGGACCCACTGGAGAAGCTCCCTGAATACTACAAGCCTTGGATGACCATTGCTGGAGATCTGTGCAACCTCATCAAGAATAAACAGATTCGGGAAGCAGTCAGACAGATGCCAGAGCTGTCCCTAAAGTACCTCTCAGGGCACAGAGAGCAGCGCCTCGCCCGTCTGATTCTGGGTCACATTGTCATGGGCTACGTGTGGCAAGATGGAGAGCAAGGGGCTGTAAAGGTTCTGCCCCGGTGCCTGGCTGTGCCCTACTTCACTCTGTCAGAAGTGCTTGGCATGCCACCCATCTTGGTCCATGCTGATCTCGTGTTGGCCAACTGGCGGCGTAAAAACCCTCATGGACCTCTGACCATGGAGAACCTGACAACCATAGTGTCCTTGCCAGGAGGGGACAGTCTGCAGGGCTTTGCGCTAGTAACGCTGATGGTGGAGGTCGCTGCTATCCCAGGGGTGCAGGCCGTTTGTCAGGCAGTGAATTCGCTAGTCTGTCAGGATGAGCCCAAGCTTCTGCAAGCACTGAAGGATCTGACCGAATCCATCAACAGGATGAACGATGCTCTGAAACTCATGCACGATTATGTTGAATCCTGACTTATTTTACAACACAATTCGCCTATTTCTGTCCCGGTGGGAAGAAACACCCGTCCCTTCCCAAAAGGGCCCGCCGATATTGAGGGGTAAACAAAAAGCCCCCGTTCCCCTTTTCTTCCAGAAGGCGTTTTCCGGCCCCAAAAGTTTTTTG
Full Trace Sequence: GGGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAATCAAGATATTAATCCCAAGGAGTTCTATGTGTCTGAACAATATGGATTTATTCTCCAGGACCCACTGGAGAAGCTCCCTGAATACTACAAGCCTTGGATGACCATTGCTGGAGATCTGTGCAACCTCATCAAGAATAAACAGATTCGGGAAGCAGTCAGACAGATGCCAGAGCTGTCCCTAAAGTACCTCTCAGGGCACAGAGAGCAGCGCCTCGCCCGTCTGATTCTGGGTCACATTGTCATGGGCTACGTGTGGCAAGATGGAGAGCAAGGGGCTGTAAAGGTTCTGCCCCGGTGCCTGGCTGTGCCCTACTTCACTCTGTCAGAAGTGCTTGGCATGCCACCCATCTTGGTCCATGCTGATCTCGTGTTGGCCAACTGGCGGCGTAAAAACCCTCATGGACCTCTGACCATGGAGAACCTGACAACCATAGTGTCCTTGCCAGGAGGGGACAGTCTGCAGGGCTTTGCGCTAGTAACGCTGATGGTGGAGGTCGCTGCTATCCCAGGGGTGCAGGCCGTTTGTCAGGCAGTGAATTCGCTAGTCTGTCAGGATGAGCCCAAGCTTCTGCAAGCACTGAAGGATCTGACCGAATCCATCAACAGGATGAACGATGCTCTGAAACTCATGCACGATTATGTTGAATCCTGACTTATTTTACAACACAATTCGCCTATTTCTGTCCCGGTGGGAAGAAACACCCGTCCCTTCCCAAAAGGGCCCGCCGATATTGAGGGGTAAACAAAAAGCCCCCGTTCCCCTTTTCTTCCAGAAGGCGTTTTCCGGCCCCAAAAGTTTTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAATCAAGATATTAATCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837843
dbEST ID: 79655545
Trimmed Sequence: GCAGTCCTCTTGTGTGTCATTATTCAGAACACCCTCCTTGCATGTGCCCCTGACATTCTTTAGAAAGGACATGATGTTGGACCCTCCTGTGCCCCTCTCATGTAAATGTTGCTCCATCTTTCCTAACATCTTGGAGCGGTTTCCTGCTGCGCTCACATACTTGCAGACTATGCGAATATGGAGGGAGCGGAAGTCCGTGAGGGACAAGACGCATTCATTAAAGGCAGAGAGGAGTTCAGGGTCCCCGCTTTCTTGAACGTATCCCGGGAGAGAAGGTGCCTTGCCAATCCTCTCTACAAAGTGGCGGTGTGCCGGGGGCATGTACTCTCGCATCCGCAATAGGAAGTCGGCGCTGTCTGATCTGTGCTTAATTCCCAACAGTTCATCAAAGGCCTGAAATACAGAACTCTGTGCCGCACTGCCTCCTGAGAAAGAGAACGGGGTTTCTGCTACCCCTTCATATCGCAGCCCCTCTGGCATGGACGGGTTGTCCTTCCACCCGGACAGAAATAGGCGAATTGTGTTGTAAAATATGTCAGAATCCACATAATCGTGCATGAGTTTCAGAGCATCGCTCATCCTGTTGATGGATTCGGTCAAATCCTTCATTGCTTGCAGAAACCTCGGCTCATCCTGACAAAATAGCGAATTCACTGCCTGACAAACGGCCTGCACCCCCTGGATAGCGACGACCTCCCACCATCACCTTTACTACCGCCAAGCCCTGCAGACTGTCTCCTCCTGGCCAGAACACTATGGTTGTCAGGTTCCTCCTGGTCAGAGGTCAATTAAGGTTTTTACGCCCCCATTTGCCCAACAAAAAATAACAAGGACCAACAAGGGTTGGCATGCCGGGCACTTTCTAAAAAATGAAAAAAGGACCAAACGAGCGCCAGGGGGAAAACCTTAAACCCCCTTCCCCTCCTCCTCCCCCACAAAGCCAATAAAAATGAAACCAAAAATCAAAAAAGCAAAGACGCTTCCCTCTTTTCCCTTAAAAGGGTCTTGAAGGAAAACCCTCTTCCATCTCGGTTTGAAGCGCTTCCGAGAGACGTTGTTAGTTTTTTTAGTGGGATTTTGCCCAGGAAAGCGGCGCAGGAGGCGGTGGATTCGCCCCCAAGGGCGGTTGTATGAAAGTAAGTTAGAGGGAGAGGGAGGTGTGGTCGCGCGCAGA
Full Trace Sequence: GGCCAGGGTAACAGCTATGGACCATGTAATACGACTCACTATNAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGTCCTCTTGTGTGTCATTATTCAGAACACCCTCCTTGCATGTGCCCCTGACATTCTTTAGAAAGGACATGATGTTGGACCCTCCTGTGCCCCTCTCATGTAAATGTTGCTCCATCTTTCCTAACATCTTGGAGCGGTTTCCTGCTGCGCTCACATACTTGCAGACTATGCGAATATGGAGGGAGCGGAAGTCCGTGAGGGACAAGACGCATTCATTAAAGGCAGAGAGGAGTTCAGGGTCCCCGCTTTCTTGAACGTATCCCGGGAGAGAAGGTGCCTTGCCAATCCTCTCTACAAAGTGGCGGTGTGCCGGGGGCATGTACTCTCGCATCCGCAATAGGAAGTCGGCGCTGTCTGATCTGTGCTTAATTCCCAACAGTTCATCAAAGGCCTGAAATACAGAACTCTGTGCCGCACTGCCTCCTGAGAAAGAGAACGGGGTTTCTGCTACCCCTTCATATCGCAGCCCCTCTGGCATGGACGGGTTGTCCTTCCACCCGGACAGAAATAGGCGAATTGTGTTGTAAAATATGTCAGAATCCACATAATCGTGCATGAGTTTCAGAGCATCGCTCATCCTGTTGATGGATTCGGTCAAATCCTTCATTGCTTGCAGAAACCTCGGCTCATCCTGACAAAATAGCGAATTCACTGCCTGACAAACGGCCTGCACCCCCTGGATAGCGACGACCTCCCACCATCACCTTTACTACCGCCAAGCCCTGCAGACTGTCTCCTCCTGGCCAGAACACTATGGTTGTCAGGTTCCTCCTGGTCAGAGGTCAATTAAGGTTTTTACGCCCCCATTTGCCCAACAAAAAATAACAAGGACCAACAAGGGTTGGCATGCCGGGCACTTTCTAAAAAATGAAAAAAGGACCAAACGAGCGCCAGGGGGAAAACCTTAAACCCCCTTCCCCTCCTCCTCCCCCACAAAGCCAATAAAAATGAAACCAAAAATCAAAAAAGCAAAGACGCTTCCCTCTTTTCCCTTAAAAGGGTCTTGAAGGAAAACCCTCTTCCATCTCGGTTTGAAGCGCTTCCGAGAGACGTTGTTAGTTTTTTTAGTGGGATTTTGCCCAGGAAAGCGGCGCAGGAGGCGGTGGATTCGCCCCCAAGGGCGGTTGTATGAAAGTAAGTTAGAGGGAGAGGGAGGTGTGGTCGCGCGCAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGTCCTCTTGTGTGTCATT