ORFeome > ifitm3 ORF1 – XORFeome v1.0

ifitm3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ifitm3
Gene ID: 6255518
Gene Page ID: 5852509
ORF Xenbase ID: 17280039

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130140
Original XGC clone length: 435

Human orthology & disease relationships

NCBI Entrez ID: 10410
Ensembl gene IDs: ENSG00000142089
Directly associated (OMIM) disease MIM numbers: 614680
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ838531
dbEST ID: 79656233
Trimmed Sequence: ATGAGCCACAATTCTCAAGCCTTCTTGTCCACCAATGCCGGGCTTCCTCCAAGCTATGAGACAATCAAAGAGGAGTACGGGGTGACTGAGCTGGGGGAACCCAGCAACTCAGCTGTTGTGAGGACCACCGTGATCAACATGCCCAGAGAGGTGTCGGTGCCTGACCATGTGGTCTGGTCCCTGTTCAATACACTCTTCTTCAACGCCTGCTGCCTGGGCTTCGTTGCCTATGCCTACTCTGTGAAGTCTAGGGACAGGAAAATGGTGGGCGATGTGGTTGGAGCCCAGGCCTACGCCTCCACTGCCAAGTGCCTGAATATCAGCTCCCTGATCTTCAGCATCCTTATGGTCATTATCTGCATCATTATTTTCTCTACCACCTCTGTGGTAGTCTTTCAGTCTTTTGCACAAAAAACACCCCATTCTGGATTCTT
Full Trace Sequence: CTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCACAATTCTCAAGCCTTCTTGTCCACCAATGCCGGGCTTCCTCCAAGCTATGAGACAATCAAAGAGGAGTACGGGGTGACTGAGCTGGGGGAACCCAGCAACTCAGCTGTTGTGAGGACCACCGTGATCAACATGCCCAGAGAGGTGTCGGTGCCTGACCATGTGGTCTGGTCCCTGTTCAATACACTCTTCTTCAACGCCTGCTGCCTGGGCTTCGTTGCCTATGCCTACTCTGTGAAGTCTAGGGACAGGAAAATGGTGGGCGATGTGGTTGGAGCCCAGGCCTACGCCTCCACTGCCAAGTGCCTGAATATCAGCTCCCTGATCTTCAGCATCCTTATGGTCATTATCTGCATCATTATTTTCTCTACCACCTCTGTGGTAGTCTTTCAGTCTTTTGCACAAAAAACACCCCATTCTGGATTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTTTTGCAACAAACAGGTCACTTTCAGTCAAAAAAAAATCATTATTTGCCATCCACCTGAAATCCCCTATAGTGATTCCTAATAAAATGGTCAAACCTGTTTCAAAAAAAAAAAAAAACCGTGTCCCCGAATCTCTTGATGTCCAAAANTAACCAGAGAAAAAAGTGTCTTTCTTTGAGAATCCCGTTTTGTTTGGAGGGATTACAGAGTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAACAATGAAAGTAATTAAATCTATAGAGTGGAATAAAGAATGATGTGAATCTGCAAATATNTAAACAGACAAANTTATGTCGGAAGTTGGGCAAGAGGTAGGTGATGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCACAATTCTCAAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838530
dbEST ID: 79656232
Trimmed Sequence: GAATCCAGAATGGGGTGTTCTTTGTGCAAAAGACTGAAAGACTACCACAGAGGTGGTAGAGAAAATAATGATGCAGATAATGACCATAAGGATGCTGAAGATCAGGGAGCTGATATTCAGGCACTTGGCAGTGGAGGCGTAGGCCTGGGCTCCAACCACATCGCCCACCATCTTCCTGTCCCTAGACTTCACAGAGTAGGCATAGGCAACGAAGCCCAGGCAGCAGGCGTTGAAGAAGAGTGTATTGAACAGGGACCAGACCACATGGTCAGGCACCGACACCTCTCTGGGCATGTTGATCACGGTGGTCCTCACAACAGCTGAGTTGCTGGGTTCCCCCAGCTCAGTCACCCCGTACTCCTCTTTGATTGTCTCATAGCTTGGAGGAAGCCCGGCATTGGTGGACAACAAGGCTTGAGAATTGTGGCTCACGG
Full Trace Sequence: GAAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAATCCAGAATGGGGTGTTCTTTGTGCAAAAGACTGAAAGACTACCACAGAGGTGGTAGAGAAAATAATGATGCAGATAATGACCATAAGGATGCTGAAGATCAGGGAGCTGATATTCAGGCACTTGGCAGTGGAGGCGTAGGCCTGGGCTCCAACCACATCGCCCACCATCTTCCTGTCCCTAGACTTCACAGAGTAGGCATAGGCAACGAAGCCCAGGCAGCAGGCGTTGAAGAAGAGTGTATTGAACAGGGACCAGACCACATGGTCAGGCACCGACACCTCTCTGGGCATGTTGATCACGGTGGTCCTCACAACAGCTGAGTTGCTGGGTTCCCCCAGCTCAGTCACCCCGTACTCCTCTTTGATTGTCTCATAGCTTGGAGGAAGCCCGGCATTGGTGGACAACAAGGCTTGAGAATTGTGGCTCACGGTGCCTACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCCACAAACAGGTCACTATCATTCCAAAATAATTATTTTATTTGGGGCGAAAAAAAAAAAAAAAAACAAACGAATTTACAAATCGTTAGAACGGGGGAAGGAAAAAAAAAAAAAAAGGGGCCCCCTTCTAGAAGACGGAGGTGTTCGGGGGGGGGAAGAAAAAAAAAAAAAGAAAAAAAAAAGAAAACAGAGGGGGGAGAAAAAGGTGGATATAGAAAAAAAGAGAAGAAGGGGNNGNGNNNGGGGGGGGNNGNNNNGGGGGGGGGGGGGAAAGAGNNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAATCCAGAATGGGGTGT