ORFeome > ift27 ORF1 – XORFeome v1.0

ift27 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ift27
Gene ID: 6252776
Gene Page ID: 1001554
ORF Xenbase ID: 17280063

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123274
Original XGC clone length: 561

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ838779
dbEST ID: 79656481
Trimmed Sequence: ATGGTGAAACTTTCAGCCAAGTGCATTGTAGCAGGTGACACAGCTGTGGGGAAAAGTACCCTGGTCCAACTTTTCCGGAGCGATGGGAGCCATTTCCCAAAGAATTACAGTATGACCGCTACCGTGGAGGTTTCTGTAAAAACAGTTCAGATTCCAGATACCGGAGACAGTGTGGAGCTCTTCCTCTGCGACAGTCCTGGCAAAGCAATCTTTTATGAGATGACAGAGAAGCTGTGGGACCAGCCGGGAGCACTGTGCTTGGTGTTTGATGTCACCAATGAGAGCTCATTCAGTAGCTGCACTAAGTGGTTGCAGAGAGTTAGATCGAAGACATTGAGCCCTCATCTCCCAGGTGTGCTTGTGGGTAACAAGACAGACATGGCAGGACTCAGAGCAGTGGAAAAGGGGCAGGCGGAACAGTGGGCAGCAAGCAACGGACTGGAGTATTTTGAGACTTCTGCGAAAGAACTGGAAAACTTTGAGCGGCCATTTCAAGCACTGGCAAAAGCTTTTCCTCACCTGGACCAGGAAAGAGTGGAGCACTTCCAGAGCCTGGTGTT
Full Trace Sequence: TCGGGGCCCACATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAAACTTTCAGCCAAGTGCATTGTAGCAGGTGACACAGCTGTGGGGAAAAGTACCCTGGTCCAACTTTTCCGGAGCGATGGGAGCCATTTCCCAAAGAATTACAGTATGACCGCTACCGTGGAGGTTTCTGTAAAAACAGTTCAGATTCCAGATACCGGAGACAGTGTGGAGCTCTTCCTCTGCGACAGTCCTGGCAAAGCAATCTTTTATGAGATGACAGAGAAGCTGTGGGACCAGCCGGGAGCACTGTGCTTGGTGTTTGATGTCACCAATGAGAGCTCATTCAGTAGCTGCACTAAGTGGTTGCAGAGAGTTAGATCGAAGACATTGAGCCCTCATCTCCCAGGTGTGCTTGTGGGTAACAAGACAGACATGGCAGGACTCAGAGCAGTGGAAAAGGGGCAGGCGGAACAGTGGGCAGCAAGCAACGGACTGGAGTATTTTGAGACTTCTGCGAAAGAACTGGAAAACTTTGAGCGGCCATTTCAAGCACTGGCAAAAGCTTTTCCTCACCTGGACCAGGAAAGAGTGGAGCACTTCCAGAGCCTGGTGTTGCCAACTTTCTTGTATCAAGTTGGCATTATAAGAAACAATGGCTTATCATTTTGTTGCAACAAACAGGTCACTAATCAATCAAATAAAAACATTAATTTTCCCTCCCGCCTGATAACGCCCTAAAGTGAGTCGGAATAGCATGAAAAAAAAAAAAAAAAAAAAAAAATATTACCAAGTGGTGCGGAATCCGCTCAAGAAAAAAAAGAGAGTAGTTTCCCGCCACGAGGGTGAGTGAGTGAGTAGTAATGGGTGTAGAGAAGAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAAACTTTCAGCCAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838778
dbEST ID: 79656480
Trimmed Sequence: CACCAGGCTCTGGAAGTGCTCCACTCTTTCCTGGTACAGGTGATGAAAAGCTTTTGCCAGTGCTTGAAATGGCCGCTCAAAGTTTTCCAGTTCTTTCGCAGAAGTCTCAAAATACTCCAGTCCGTTGCTTGCTGCCCACTGTTCCGCCTGCCCCTTTTCCACTGCTCTGAGTCCTGCCATGTCTGTCTTGTTACCCACAAGCACACCTGGGAGATGAGGGCTCAATGTCTTCGATCTAACTCTCTGCAACCACTTAGTGCAGCTACTGAATGAGCTCTCATTGGTGACATCAAACACCAAGCACAGTGCTCCCGGCTGGTCCCACAGCTTCTCTGTCATCTCATAAAAGATTGCTTTGCCAGGACTGTCGCAGAGGAAGAGCTCCACACTGTCTCCGGTATCTGGAATCTGAACTGTTTTTACAGAAACCTCCACGGTAGCGGTCATACTGTAATTCTTTGGGAAATGGCTCCCATCGCTCCGGAAAAGTTGGACCAGGGTACTTTTCCCCACAGCTGTGTCACCTGCTACAATGCACTTGGCTGAAAGTTTCACCATGG
Full Trace Sequence: GGTAACANGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCAGGCTCTGGAAGTGCTCCACTCTTTCCTGGTACAGGTGATGAAAAGCTTTTGCCAGTGCTTGAAATGGCCGCTCAAAGTTTTCCAGTTCTTTCGCAGAAGTCTCAAAATACTCCAGTCCGTTGCTTGCTGCCCACTGTTCCGCCTGCCCCTTTTCCACTGCTCTGAGTCCTGCCATGTCTGTCTTGTTACCCACAAGCACACCTGGGAGATGAGGGCTCAATGTCTTCGATCTAACTCTCTGCAACCACTTAGTGCAGCTACTGAATGAGCTCTCATTGGTGACATCAAACACCAAGCACAGTGCTCCCGGCTGGTCCCACAGCTTCTCTGTCATCTCATAAAAGATTGCTTTGCCAGGACTGTCGCAGAGGAAGAGCTCCACACTGTCTCCGGTATCTGGAATCTGAACTGTTTTTACAGAAACCTCCACGGTAGCGGTCATACTGTAATTCTTTGGGAAATGGCTCCCATCGCTCCGGAAAAGTTGGACCAGGGTACTTTTCCCCACAGCTGTGTCACCTGCTACAATGCACTTGGCTGAAAGTTTCACCATGGTGCCAAATTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTCCAACGAAAAGGTCAATATCAGTTCAAAATAAAATCAATAAAAAAGGGCAAAGAACTAACAACTGCCCGCCGTTTAAGATATCCCCCTTAACCAAAGAAAAAGCCGCTCGTTCTCNCCACACCGGGTTTTGTTTGGATTAACGGCATTGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCAGGCTCTGGAAGT