ORFeome > ighv4-31 ORF1 – XORFeome v1.0

ighv4-31 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ighv4-31
Gene ID: 6466078
Gene Page ID: 5904758
ORF Xenbase ID: 17280135

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC081242
Original XGC clone length: 1719

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ839643
dbEST ID: 79657345
Trimmed Sequence: ATGTGTCCTCTCTCAGACATTACAAAATTCTGGTCCTGGAACTGTGAAACCCTCATAGTCACTCATACTGACCTGCACAGTTTCTGGGTTGAGCTAAGCAGGTATTATATTAGCTGGGCCAGGCAGCCTCCTGGGAAGAGACTGGAATGGATTGGGCTTGCATATGCTGATGGGAGCACAGCTATTGCTGATTCACTAAAAAACAGAGTTACAATTACTAAAGACAATGGGAAGAAGCAGGTCTACCTCCAAATGAATGGGATGGAAGTTAAAGACACTGCCATGTATTACTGTGCAAGAGGTAGCGGGTACAACTTTGACTACTGGGGACAAGGGACCATAGTCACCGTCACTTCAACTACTTCAAAATCCCCATCCCTTTTTCCACTCATTTCTTGTGGGGAGTCTATGGACCCAGTCACCATTGGTTGTTTGGCCAAAGATTTTCTCCCTGAAACTATTAGCTTCACCTGGGGAGATAAGAACAATGCCAGTTACTCCACTGGCCTCAAGAGCTATAAACCTGTGATGCAATCTTCCGGCACCTACTCAGCCAGCTCCCAAGTCAACGTTGCCTCTGCAGTCTGGGACAACATTGAACAATTTTACTGCAATGCCAAACACCTGGATACCATTTAGAGTGTGGAACTCAAGAAAAATCCAGTGAAACAGTTTGAAAAACCATTTGTGTCTATTCACCTTCATTCCAAGATCCTCTTTCCTTGGATGAAAGCCTCTTTTTCGAATTGTCTTGCAAGAAATTTTTCTCCCAACCAATTTAGTTATATAAAATGGTTTAAAGAATTGGGAAACCAAAAAACAAAAAAAGGTG
Full Trace Sequence: TCGGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTCCTCTCTCAGACATTACAAAATTCTGGTCCTGGAACTGTGAAACCCTCATAGTCACTCATACTGACCTGCACAGTTTCTGGGTTGAGCTAAGCAGGTATTATATTAGCTGGGCCAGGCAGCCTCCTGGGAAGAGACTGGAATGGATTGGGCTTGCATATGCTGATGGGAGCACAGCTATTGCTGATTCACTAAAAAACAGAGTTACAATTACTAAAGACAATGGGAAGAAGCAGGTCTACCTCCAAATGAATGGGATGGAAGTTAAAGACACTGCCATGTATTACTGTGCAAGAGGTAGCGGGTACAACTTTGACTACTGGGGACAAGGGACCATAGTCACCGTCACTTCAACTACTTCAAAATCCCCATCCCTTTTTCCACTCATTTCTTGTGGGGAGTCTATGGACCCAGTCACCATTGGTTGTTTGGCCAAAGATTTTCTCCCTGAAACTATTAGCTTCACCTGGGGAGATAAGAACAATGCCAGTTACTCCACTGGCCTCAAGAGCTATAAACCTGTGATGCAATCTTCCGGCACCTACTCAGCCAGCTCCCAAGTCAACGTTGCCTCTGCAGTCTGGGACAACATTGAACAATTTTACTGCAATGCCAAACACCTGGATACCATTTAGAGTGTGGAACTCAAGAAAAATCCAGTGAAACAGTTTGAAAAACCATTTGTGTCTATTCACCTTCATTCCAAGATCCTCTTTCCTTGGATGAAAGCCTCTTTTTCGAATTGTCTTGCAAGAAATTTTTCTCCCAACCAATTTAGTTATATAAAATGGTTTAAAGAATTGGGAAACCAAAAAACAAAAAAAGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTCCTCTCTCAGACATT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGGTATCAGACAAGACGAGGGACACATTCACGTTAGTAGGTTTACCAGAAGACTTGTCAATGCTCCTTTGGGTCAGCTGAAGTGGCAATGACTCATGGCCAACCACACAGGAAAAACTATCACCAGCATCCCAGTCTTTAATGTCTAAGGTGTGACGACTGGAGCCAAATATCTTGCACCTCTTCTGTCTTATGGGTAAACGCTCGTCATTGATGCGGGGCTTCAAGCAAGTCAGTATCGGACCCAATAACATCATTGTTTGGCCGCCCTACCTATATATCGGACGGGCTGATAAATTTAACCAAGCATGTCAAGGTGGCAGTTTCTCTCTTAGACAATTCCTCAAGAGGTGGTGGGAAAACATATACCGATGGTGTATTGTATTCTCCTTTTTCTTTAAAGAGAAAGACCTCCTTCATTGAAGCCAGCTCTGTGTGTTCCACTTTGCGGACAAACTTGTCGGTAGTCCTTTACTCTAGGCACACAATGGTGGTTCCGGTTACAGAGTACGAGGGGTTAACATTATATCAGTGTCCTGCGGGTGCGGGTTTGCATGGTTCCTCTGGATTCCCAGATTTTATAACCCTTGTATATGGACTCAGATCGTCCTAGTTAGCCGAATAACTGGACAGGCCAGGTACGTGTGGGGGCAGCTTCCATCAAACTGCCTCGCTAAGGAGGGGTGGAAAAGGGATTGCTGTCAACCAAGAGGGGTGGTCAATTGGAGTGTGGGGTACTCGGTGAGGTTTCCCAGTATTTCGGGGCTGTGTAACG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGGTATCAGACAAGACGAG