ORFeome > il8 ORF1 – XORFeome v1.0

il8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: il8
Gene ID: 6256174
Gene Page ID: 6257607
ORF Xenbase ID: 17280231

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128939
Original XGC clone length: 312

Human orthology & disease relationships

NCBI Entrez ID: 3576
Ensembl gene IDs: ENSG00000169429
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 300291,300301,300584,308300

Library Location

Plate ID: GDExl11086
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ837819
dbEST ID: 79655521
Trimmed Sequence: ATGGAAACCAAGAGAAGTGTCCTGGCAATACTGGCTCTCTGCCTGTTATGCGCTGCAGTAACAGAAAGCATCCCAGTGTCAAGGACCGGAGAACTCAGGTGTTTGTGCATAAAGACAGAAAGCAAGCCTATCCATCCCAAGCACATAAAGAATATCGAGATGATCCCTAAAGGGCCCCACTGCAAAAACGTGGAAGTCATTGCAACTTTGACAAGTGGGGACGATATCTGCTTGGAGCCAACAGCCCCATGGGTTAAGAGGATCATTGAAAAAATTCTAGCTAGCTCTAAGACACCTGTTTCTGCTCTTTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAACCAAGAGAAGTGTCCTGGCAATACTGGCTCTCTGCCTGTTATGCGCTGCAGTAACAGAAAGCATCCCAGTGTCAAGGACCGGAGAACTCAGGTGTTTGTGCATAAAGACAGAAAGCAAGCCTATCCATCCCAAGCACATAAAGAATATCGAGATGATCCCTAAAGGGCCCCACTGCAAAAACGTGGAAGTCATTGCAACTTTGACAAGTGGGGACGATATCTGCTTGGAGCCAACAGCCCCATGGGTTAAGAGGATCATTGAAAAAATTCTAGCTAGCTCTAAGACACCTGTTTCTGCTCTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCCGCTCTAAAATAAAAAAAAAAAGATATGTTATTACACCACTCCGAAACGCCAGGGATCAAAAGAAAAAAAAACCTCGCCCGCAAAGTGGGCCGTGGGGTATCCGTGGGAGGGGGGGAGAGGGCAAACCCCCCGGGCAAACCCCCGCTGGCCGGGGGGTTGGGAGGGGAAAAAACCACGGGGGCCAACACCCAGGGCCAAAACCAATTCCGAAGGAAGAAGGGGCCGGGGGGGGGGGTGGGTTTTTTTGGGTATGGAAAAAAAAAATTTTTTAGGTCGCCACACGACACCCATGGCGGGGCCAGAGAACAAGAGATAAAAAGGAGAAAAGGCGCGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAACCAAGAGAAGTGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837818
dbEST ID: 79655520
Trimmed Sequence: AAGAGCAGAAACAGGTGTCTTAGAGCTAGCTAGAATTTTTTCAATGATCCTCTTAACCCATGGGGCTGTTGGCTCCAAGCAGATATCGTCCCCACTTGTCAAAGTTGCAATGACTTCCACGTTTTTGCAGTGGGGCCCTTTAGGGATCATCTCGATATTCTTTATGTGCTTGGGATGGATAGGCTTGCTTTCTGTCTTTATGCACAAACACCTGAGTTCTCCGGTCCTTGACACTGGGATGCTTTCTGTTACTGCAGCGCATAACAGGCAGAGAGCCAGTATTGCCAGGACACTTCTCTTGGTTTCCATGG
Full Trace Sequence: GGGGCGGGGAACAGCTTATGAACAGGGTAAAACGAACCACTATACGGGGAAAACAGCCTGGAGGGCAATAATGATATTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAGCAGAAACAGGTGTCTTAGAGCTAGCTAGAATTTTTTCAATGATCCTCTTAACCCATGGGGCTGTTGGCTCCAAGCAGATATCGTCCCCACTTGTCAAAGTTGCAATGACTTCCACGTTTTTGCAGTGGGGCCCTTTAGGGATCATCTCGATATTCTTTATGTGCTTGGGATGGATAGGCTTGCTTTCTGTCTTTATGCACAAACACCTGAGTTCTCCGGTCCTTGACACTGGGATGCTTTCTGTTACTGCAGCGCATAACAGGCAGAGAGCCAGTATTGCCAGGACACTTCTCTTGGTTTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGAAAGAAAAATACAACATAATGACTGGGGGGCCTTGGGAACGGCCGGGAAAAAAAGACAAAAAGTGTTGGTCCCAAAAGGGGGGCGTTGGGATGGTCCCTGGGTAAAAGATAAGAGAATAACCCAAAACGAAAAATACGGGGGGGCTGTTTGAAGGTTTGGGAGAAAAGGAGGGGGCGGCCGCCACGGGGAAAAAACTCCGACGGAGAGGAAGTTTGGGGCGGGGCGAGGGGGGGGTTCCGGGGTGGGGGGACATTATTTTTGGGGGGGAAGGCGAGCCCGGGGAAGCAGCGCGAGAGAGGGTTATCCGGGGGGTGGGGGGGTTGTTTTTGGGTGAGAAAAAATTTTACACCAGAGGGCAACCCCCGGGCGAGGGGGGTGAGAAGTGTGGGGGGAGGGGAGTGGTCGGGGGAGGAAGCGAGCAGCCACCAAGGAGGGGGGAGGAGCGGGCGCGGCCGGCAGCAGAGAGAGNGGGGGGGGATAAAAGAGACAACAGCCAGACGGAGAGAAGAGAGANGGAGGGGGGAAGAGAGAAGGNAAGTGGNTGGCAGGGGGGGGAAAAAGGGAGGAAGGGAANGGGGGGTGGGGAGAAAGGGNCGCTCCGGGGAAGGCAGGCGGGAAACCGGGAGGAAGAAGGACGAGGAGGGGAGGAGAAAGAAGAGAATGAAAGTAAAGAGAAAGAGAAGAGAGGACGAGGGNGGGGAAGAGNGGNGGGGGNAGGGAGNGACGGGGCGGGGCACGGGAAGAGAGGGGGAGAAGGGGAGGGGGTGGAGGAGCGAGGGCGTGCGTGCCGGACCGGGGGCGCCCGGNCACCGGCAGCCGCGGNNCGAGCAAGGAGNGTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGCAGAAACAGGTGTCTTA