ORFeome > ilf2 ORF1 – XORFeome v1.0

ilf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ilf2
Gene ID: 876487
Gene Page ID: 876476
ORF Xenbase ID: 17280243

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043981
Original XGC clone length: 1167

Human orthology & disease relationships

NCBI Entrez ID: 3608
Ensembl gene IDs: ENSG00000143621
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151623,275355,300049,300537,304120,305620,309350,311300,606593,608232

Library Location

Plate ID: GDExl11015
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ824263
dbEST ID: 79641965
Trimmed Sequence: ATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGATGCCTCCCATCTACAGTGAAGGTTTTAATCGGGTTGTGAAAGACTTGAGGAGTCGGTTTCCTGGATCGAANNCTCTACTCCCTGGATCCTGGACCTCTNGGGTCACTTATGCGTGATGAAACACCCCAACCCAGGCAGCACTGGGGCACTTAAGGTGGCCTACCAAACCCTGGCCTACGAATTTTTCCCGTCCC
Full Trace Sequence: CCATATATGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGATGCCTCCCATCTACAGTGAAGGTTTTAATCGGGTTGTGAAAGACTTGAGGAGTCGGTTTCCTGGATCGAANNCTCTACTCCCTGGATCCTGGACCTCTNGGGTCACTTATGCGTGATGAAACACCCCAACCCAGGCAGCACTGGGGCACTTAAGGTGGCCTACCAAACCCTGGCCTACGAATTTTTCCCGTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGGTGAACGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829589
dbEST ID: 79647291
Trimmed Sequence: CTCTTGTGTCTCCATACTCTCCTCCTCTTCTGCCCCCTCAGCAATTTCCTGGTTATCATCCTCCTCTCCTTCTTTCCTTTCAGGGGGCTTCTCATAGGCCTTCTCTGAAGGGGTCACAATGACACCATCCCAGGTGGACATTTCTGTGGCAAGAGCACTGGCATCTCCCTCCAGGCCCAAAATCTTCCTGTAGCCTCCGTGTGAGAGAATTCGGACCAACGTCTGGGCAGTGTAACAAACCATGTCCTGCTGCTCCAGAGTCATGACAGTGTGAACCCTGAAATTTCCACTTTCACAGGGGTCTGTAATGCCAACTGAGCCAGGGAGGAAGAGGCCGGCAGCGAGAATCTGTAGGCAGCGTTTGTAGGCCACATTAAGTGCCAGTGGCTGCCTGGTTGGGTTGTTCATCACTGCATAGTGACCCAAGAGGTCCAGGATCCAGGGAGTTAGAGGTTCGAATCCAGGAAACCGACTCCTCAAGTCTTTCAACAACCGGATTAAAACCTTCACTGTAGAATGGGAGGCATTCTCCTCAAACCAGCGTGCGTGCCTGATGGCTGCCAGTGCGCTCTGTAGAACTTTGATGTCCAAGTGTAATTCTGGGTCCAGCTTGCGGAGATTTGGTGGTACAGTTGTGATAAGGATCTTAATGGTGGCGTCTGCTGAGCTGATTTCAAAGCCAGT
Full Trace Sequence: GCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTGTGTCTCCATACTCTCCTCCTCTTCTGCCCCCTCAGCAATTTCCTGGTTATCATCCTCCTCTCCTTCTTTCCTTTCAGGGGGCTTCTCATAGGCCTTCTCTGAAGGGGTCACAATGACACCATCCCAGGTGGACATTTCTGTGGCAAGAGCACTGGCATCTCCCTCCAGGCCCAAAATCTTCCTGTAGCCTCCGTGTGAGAGAATTCGGACCAACGTCTGGGCAGTGTAACAAACCATGTCCTGCTGCTCCAGAGTCATGACAGTGTGAACCCTGAAATTTCCACTTTCACAGGGGTCTGTAATGCCAACTGAGCCAGGGAGGAAGAGGCCGGCAGCGAGAATCTGTAGGCAGCGTTTGTAGGCCACATTAAGTGCCAGTGGCTGCCTGGTTGGGTTGTTCATCACTGCATAGTGACCCAAGAGGTCCAGGATCCAGGGAGTTAGAGGTTCGAATCCAGGAAACCGACTCCTCAAGTCTTTCAACAACCGGATTAAAACCTTCACTGTAGAATGGGAGGCATTCTCCTCAAACCAGCGTGCGTGCCTGATGGCTGCCAGTGCGCTCTGTAGAACTTTGATGTCCAAGTGTAATTCTGGGTCCAGCTTGCGGAGATTTGGTGGTACAGTTGTGATAAGGATCTTAATGGTGGCGTCTGCTGAGCTGATTTCAAAGCCAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTGTGTCTCCATACTCT