ORFeome > ing3 ORF1 – XORFeome v1.0

ing3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ing3
Gene ID: 972311
Gene Page ID: 972304
ORF Xenbase ID: 17280357

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045263
Original XGC clone length: 1251

Human orthology & disease relationships

NCBI Entrez ID: 54556
Ensembl gene IDs: ENSG00000071243
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 193670,203300,275355,609423

Library Location

Plate ID: GDExl11009
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ823692
dbEST ID: 79641394
Trimmed Sequence: ATGCTGTACTTGGAGGATTATCTGGAGATGATCGAGCAGCTTCCCATGGATCTGCGCGACAGGTTCACGGAAATGCGCGAGATGGACTTGCAGGTGCAGAATGCCATGGACCAATTAGAACAAAGGGTTGGGGAGTTTTTTATGAATGCTAAGAAAAATAAACCTGAATGGAGGGAAGAACAAATGGCTTCTATCAAAAAGGATTACTTCAAAGCTTTGGAAGATGCAGATGAGAAAGTTCAACTTGCAAATCAAATTTATGACTTGGTGGATCGACATTTAAGGAAATTGGACCAAGAGCTTGCTAAATTCAAGATGGAATTAGAGGCTGACAATGCAGGAATTACTGAAATATTGGAAAGAAGATCATTGGAATTAGACACTCCATCACAGCCTGTGAATAATCATCATGTTCATTCCCATTCCTCAGGAGAGAAGCGGAAGCACATTCCATCATCTCATCATTCAACAACCGATCATGTACCAGAGAAAAAGTTCAAATCTGAAGCATTGTTGTCCACTCTAACTTCAGATGCTTCTAAAGAGAACACAGCAGGCTGTAGAACTAATCTATCTTCATCTTCTACCAACAATGTCTACAATGTGAATTCTTCCCAGCCATTGACATCATATAATATAAGTTCCCTTTCCACTGGAGCTGCAGCAGGTGCAATTACCATGGCAGCAGCACAGGCAGTTCAGGGCACTGCACAGATGGAAGGAAGGGGAGACGAAACCTCCAGCCTAAAAGCAAGCCTATAAGCCCTTTAAAAAACCTGACCTGGCCTGGGGAACCCCCTTTGTTAAAAAATTCCGCCTTGCTATTTCCTCCATC
Full Trace Sequence: TATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTACTTGGAGGATTATCTGGAGATGATCGAGCAGCTTCCCATGGATCTGCGCGACAGGTTCACGGAAATGCGCGAGATGGACTTGCAGGTGCAGAATGCCATGGACCAATTAGAACAAAGGGTTGGGGAGTTTTTTATGAATGCTAAGAAAAATAAACCTGAATGGAGGGAAGAACAAATGGCTTCTATCAAAAAGGATTACTTCAAAGCTTTGGAAGATGCAGATGAGAAAGTTCAACTTGCAAATCAAATTTATGACTTGGTGGATCGACATTTAAGGAAATTGGACCAAGAGCTTGCTAAATTCAAGATGGAATTAGAGGCTGACAATGCAGGAATTACTGAAATATTGGAAAGAAGATCATTGGAATTAGACACTCCATCACAGCCTGTGAATAATCATCATGTTCATTCCCATTCCTCAGGAGAGAAGCGGAAGCACATTCCATCATCTCATCATTCAACAACCGATCATGTACCAGAGAAAAAGTTCAAATCTGAAGCATTGTTGTCCACTCTAACTTCAGATGCTTCTAAAGAGAACACAGCAGGCTGTAGAACTAATCTATCTTCATCTTCTACCAACAATGTCTACAATGTGAATTCTTCCCAGCCATTGACATCATATAATATAAGTTCCCTTTCCACTGGAGCTGCAGCAGGTGCAATTACCATGGCAGCAGCACAGGCAGTTCAGGGCACTGCACAGATGGAAGGAAGGGGAGACGAAACCTCCAGCCTAAAAGCAAGCCTATAAGCCCTTTAAAAAACCTGACCTGGCCTGGGGAACCCCCTTTGTTAAAAAATTCCGCCTTGCTATTTCCTCCATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTACTTGGAGGATTATCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829002
dbEST ID: 79646704
Trimmed Sequence: TTTATGTCTACTGCCTCTTCTCTTCATTGCAGCGGTGCACTGAGGGCAGTACCATTTGCCTTTTGGAGCTTCTGATAACCCAACACATCCATAATGAAACCATTCAATTGGGCAATCTTGGTTGTCACAGCCTACCATTTCGCCATAAGACACCTGATTGCAGATACAATAACGAGGCTCATTAGGATCGTAAGTCCAGTCAACCTGGCTGTTAGTATCAGACTCTGGAATAGCAGCAGTTTGTTGATGAGACAGTTCATGTGCTAGAGCAGATGATGAAGAGCATGATGAGAGAGAAGAGGAAGACGATGAAGAGGAAGACTGCTGGCTCGCAGATTTGTTGTTGCTCTTGCTTTTTCTTCCACTTCTTGAATCTGTGGTTGCAGATGATGTTAATGTCTGAGTTAATGTTGATGCCAGTGCTGATGATGAATAGCTAGCTGAATCTCTAGACAAGGAGATCCCAAGCAAGTCAGTGTTTTTAAAGGCTTCATAGCTGGCTTTTAGGCTGGAGGTTCGTCTCCCTTCTTTCATCTGTGCAGTTGCCTGAACTGCCTGTGCTGCTGCCATGGTAATTGCACCTGCTGCAGCTCCAGTGGAAAGGGAACTTATATTATATGATGTCAATGGGCTGGGAGAATTCACATTGTAGACATTGTTGGGTAGAAGATGAAAAATAGATAAGTTCTACAAGCCTGGCTGTGTTCTCCTTTAAAAAACATCCGTAAAATTTAAAAGTGGAACAACAAATGGCTTCCCAA
Full Trace Sequence: CTGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATGTCTACTGCCTCTTCTCTTCATTGCAGCGGTGCACTGAGGGCAGTACCATTTGCCTTTTGGAGCTTCTGATAACCCAACACATCCATAATGAAACCATTCAATTGGGCAATCTTGGTTGTCACAGCCTACCATTTCGCCATAAGACACCTGATTGCAGATACAATAACGAGGCTCATTAGGATCGTAAGTCCAGTCAACCTGGCTGTTAGTATCAGACTCTGGAATAGCAGCAGTTTGTTGATGAGACAGTTCATGTGCTAGAGCAGATGATGAAGAGCATGATGAGAGAGAAGAGGAAGACGATGAAGAGGAAGACTGCTGGCTCGCAGATTTGTTGTTGCTCTTGCTTTTTCTTCCACTTCTTGAATCTGTGGTTGCAGATGATGTTAATGTCTGAGTTAATGTTGATGCCAGTGCTGATGATGAATAGCTAGCTGAATCTCTAGACAAGGAGATCCCAAGCAAGTCAGTGTTTTTAAAGGCTTCATAGCTGGCTTTTAGGCTGGAGGTTCGTCTCCCTTCTTTCATCTGTGCAGTTGCCTGAACTGCCTGTGCTGCTGCCATGGTAATTGCACCTGCTGCAGCTCCAGTGGAAAGGGAACTTATATTATATGATGTCAATGGGCTGGGAGAATTCACATTGTAGACATTGTTGGGTAGAAGATGAAAAATAGATAAGTTCTACAAGCCTGGCTGTGTTCTCCTTTAAAAAACATCCGTAAAATTTAAAAGTGGAACAACAAATGGCTTCCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATGTCTACTGCCTCTTCTCT