ORFeome > insrr ORF1 – XORFeome v1.0

insrr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: insrr
Gene ID: 864944
Gene Page ID: 483107
ORF Xenbase ID: 17280423

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060457
Original XGC clone length: 4077

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ824796
dbEST ID: 79642498
Trimmed Sequence: ATGGACAGACAAGTTTTCCTCCTGGTCACCACTTGCTTAAAGGGAGTGCTGCTCATCTTGCTTGTATTTAACGCTAATGGAGACGCAACACATTTTTGTGGCAGCATGGACATACGCAATGACGTATCCCAATTCCGCAAGCTGGAGAACTGTACAGTCATTCAGGGAAACTTGCAGATCCTGCTCATGTTTGGCACCAAGCCCGAAGACTTCCGTGGTTTACGATTTGAACGCCTGACCATGATCACTGAATACCTACTTTTGTTTCGAGTCTATGGCTTGGAGAGCCTTCGGGACCTCTTCCCCAACCTGTCCATCATCCGAGGCACAGATCTCTTCTTTCATTATTCACTGGTGATCTTTGAGATGCCCCATCTAAGGGACATTGGCCTCCATAGTCTCACAAACATCCTAAGGGGGGCTGTGCGTATTGAACGCAACCAAGAACTGTGTCACATTTCCACCATTGATTGGAGCCTGTTGTCCGAGTCAGTGGAGAATAACTACATTGTAGGGAATAAGCCTGTAGAGGAATGTTCTGATGTCTGTCCAGGAATACGTGATTTTGGGGAGTCCTGTGTAAAAACCCCTATCAATGGAAATGTTGAGTCTCGCTGTTGGACTTCCACCTCCTGCCAGATAGTGTGCAATTGTGGTAAAGATATTGCATGCTCCAACACTGGCGAATGTTGTCACTCTGAGTGCCTGGATGGCTGTAGCAGGCCGATGATCCCCGTGCCTGCGTGGCGTGCCGTAACTTCTACTTTGATGATCAGTGACTTGCCTCCTGCCCGCCGTGAAAAAAATTAAGTAAAAAAGGGTGGGGGCTG
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACAGACAAGTTTTCCTCCTGGTCACCACTTGCTTAAAGGGAGTGCTGCTCATCTTGCTTGTATTTAACGCTAATGGAGACGCAACACATTTTTGTGGCAGCATGGACATACGCAATGACGTATCCCAATTCCGCAAGCTGGAGAACTGTACAGTCATTCAGGGAAACTTGCAGATCCTGCTCATGTTTGGCACCAAGCCCGAAGACTTCCGTGGTTTACGATTTGAACGCCTGACCATGATCACTGAATACCTACTTTTGTTTCGAGTCTATGGCTTGGAGAGCCTTCGGGACCTCTTCCCCAACCTGTCCATCATCCGAGGCACAGATCTCTTCTTTCATTATTCACTGGTGATCTTTGAGATGCCCCATCTAAGGGACATTGGCCTCCATAGTCTCACAAACATCCTAAGGGGGGCTGTGCGTATTGAACGCAACCAAGAACTGTGTCACATTTCCACCATTGATTGGAGCCTGTTGTCCGAGTCAGTGGAGAATAACTACATTGTAGGGAATAAGCCTGTAGAGGAATGTTCTGATGTCTGTCCAGGAATACGTGATTTTGGGGAGTCCTGTGTAAAAACCCCTATCAATGGAAATGTTGAGTCTCGCTGTTGGACTTCCACCTCCTGCCAGATAGTGTGCAATTGTGGTAAAGATATTGCATGCTCCAACACTGGCGAATGTTGTCACTCTGAGTGCCTGGATGGCTGTAGCAGGCCGATGATCCCCGTGCCTGCGTGGCGTGCCGTAACTTCTACTTTGATGATCAGTGACTTGCCTCCTGCCCGCCGTGAAAAAAATTAAGTAAAAAAGGGTGGGGGCTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAGACAAGTTTTCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ830165
dbEST ID: 79647867
Trimmed Sequence: GTGCTTTGCATGGCCATTCATATGATAGCAGTTTTTGTTTTTACTAGATTCTCTTTTGGAGGCTATGGTTTTTAGAGAGTTGACTTTTTCTGCCTTAGCTGGAGAGGAAGAGTTGGTAAAAGAAGGAGATGGAGGCTCATCTAAGAAGTTATTCAGAGATTGGTCAACTTCTGTGTCAGATGCCTCCATTGATCCACTCCGCTTACGCTCCTTGCTGTTGAAGAAGGACACTTGCTGGAAACTAGTATGCAAATCATCTTTTATACTCTCTAGGATCTGGAGGAAGGATGGCCGATGCTTTGGATTCTTCTGCCAACACCAACGCATTAACTCATGGAGTCTATCTGGGCAGTTTTCTGGCTTCTCCAAGATCCCGTTATCGATCACAAAATGAAGGACTTGCTCGTTCGCCATTCCCTGATAGGGCTGCTCTGCCAGCGTGGCTATTTCCCATAGCACAACACCAAATGACCAGACATCTGAATGTGTCGTAGAGATGCCATCTTTTAGAGATTCTGGAGACATCCATCTTACAGGAAGCAATGACTTGCCACCTTTACGATAGTAATCGGTTTCATAAATATCCCTGGTCATGCCAAAGTCTCCAATCTTTACTGTAAGATCTTCAGACACCATGCAGTTGCGGGCAGCCAAATCCCGATGACCAAACTTCTTTGCAGTCCAGTAAGGCATGCCATCCGGCAATTTCCCCCTGCCCATTTGGGATCCATTCCCCTTTAAAAAGAATGGCTGGGTTTACCCAGGG
Full Trace Sequence: GACAGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCTTTGCATGGCCATTCATATGATAGCAGTTTTTGTTTTTACTAGATTCTCTTTTGGAGGCTATGGTTTTTAGAGAGTTGACTTTTTCTGCCTTAGCTGGAGAGGAAGAGTTGGTAAAAGAAGGAGATGGAGGCTCATCTAAGAAGTTATTCAGAGATTGGTCAACTTCTGTGTCAGATGCCTCCATTGATCCACTCCGCTTACGCTCCTTGCTGTTGAAGAAGGACACTTGCTGGAAACTAGTATGCAAATCATCTTTTATACTCTCTAGGATCTGGAGGAAGGATGGCCGATGCTTTGGATTCTTCTGCCAACACCAACGCATTAACTCATGGAGTCTATCTGGGCAGTTTTCTGGCTTCTCCAAGATCCCGTTATCGATCACAAAATGAAGGACTTGCTCGTTCGCCATTCCCTGATAGGGCTGCTCTGCCAGCGTGGCTATTTCCCATAGCACAACACCAAATGACCAGACATCTGAATGTGTCGTAGAGATGCCATCTTTTAGAGATTCTGGAGACATCCATCTTACAGGAAGCAATGACTTGCCACCTTTACGATAGTAATCGGTTTCATAAATATCCCTGGTCATGCCAAAGTCTCCAATCTTTACTGTAAGATCTTCAGACACCATGCAGTTGCGGGCAGCCAAATCCCGATGACCAAACTTCTTTGCAGTCCAGTAAGGCATGCCATCCGGCAATTTCCCCCTGCCCATTTGGGATCCATTCCCCTTTAAAAAGAATGGCTGGGTTTACCCAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCTTTGCATGGCCATT