ORFeome > ints6 ORF1 – XORFeome v1.0

ints6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ints6
Gene ID: 6254510
Gene Page ID: 967189
ORF Xenbase ID: 17280447

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110952
Original XGC clone length: 2652

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ837717
dbEST ID: 79655419
Trimmed Sequence: ATGCCCATTTTACTTTTCCTGCTAGATACGTCCGCTTCAATGAACCAGCGCAGCCACCTGGGCACTACCTACCTGGACATAGCTAAAGGCGCAGTAGAGACTTTCATGAAGCTCAGATCCCGAGATCCTGCTAGCAAAGGAGACAGGTACATGCTGGTCACTGTGGAAAAGCCTCCATATGGGATCAAGGCTGGAGGGAAAGAAAAGCACGAAAACCTTTATAGAAGGACCTGAAAAACCTTCAATGCTGTAGGACTCACCACTCTCGGTCAACCACTGATGACATTGTTAGACATCTTTGCTTTACAAATATAAGGTACTAGCAAACTCATTGTATGGCCATTTATTACCACTATTTGGCTTCCAGCCGACAACCTAGTATAGTTATTTAGAATGCATGGTAATATCCGGAAGATGCTGGCACAAAAGAGAAGCATCGATTGTTCTTGTCTACAAAGAAAACAAGTGAAAAATCGCTTATTTAACAAAAAAGGTGTTAACAGAGAGAAATGAGCTACATTTTGTTAGAAAAGAAAAAGGCCTAGGCAGAACAAATGGAATCAATTTCACGCAGCCGAAAGAAGTTCCCGGTGATCGAGAAACAGCGCCTGGTTTTAGTGGAATAACTAAAACATCGAGGCCGCCGGGTTAAAAAACATAATCTTCAACCAAGCAAAATGAAAGGAACCTTGGAAGAAAATACATAAAAAGGGCCTAGACAAGGCGAGCCCCTTTTGTATTATTTTTTTGCGGTCGCTGAAAAAAAAAAAATGAAGGAAATATAAAAAAAAAATTTGTTTTTC
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCATTTTACTTTTCCTGCTAGATACGTCCGCTTCAATGAACCAGCGCAGCCACCTGGGCACTACCTACCTGGACATAGCTAAAGGCGCAGTAGAGACTTTCATGAAGCTCAGATCCCGAGATCCTGCTAGCAAAGGAGACAGGTACATGCTGGTCACTGTGGAAAAGCCTCCATATGGGATCAAGGCTGGAGGGAAAGAAAAGCACGAAAACCTTTATAGAAGGACCTGAAAAACCTTCAATGCTGTAGGACTCACCACTCTCGGTCAACCACTGATGACATTGTTAGACATCTTTGCTTTACAAATATAAGGTACTAGCAAACTCATTGTATGGCCATTTATTACCACTATTTGGCTTCCAGCCGACAACCTAGTATAGTTATTTAGAATGCATGGTAATATCCGGAAGATGCTGGCACAAAAGAGAAGCATCGATTGTTCTTGTCTACAAAGAAAACAAGTGAAAAATCGCTTATTTAACAAAAAAGGTGTTAACAGAGAGAAATGAGCTACATTTTGTTAGAAAAGAAAAAGGCCTAGGCAGAACAAATGGAATCAATTTCACGCAGCCGAAAGAAGTTCCCGGTGATCGAGAAACAGCGCCTGGTTTTAGTGGAATAACTAAAACATCGAGGCCGCCGGGTTAAAAAACATAATCTTCAACCAAGCAAAATGAAAGGAACCTTGGAAGAAAATACATAAAAAGGGCCTAGACAAGGCGAGCCCCTTTTGTATTATTTTTTTGCGGTCGCTGAAAAAAAAAAAATGAAGGAAATATAAAAAAAAAATTTGTTTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCATTTTACTTTTCCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837716
dbEST ID: 79655418
Trimmed Sequence: ACAGCTACTTAAGTGGTTGACTTGACTGGCCCTTCTGTGAATTTCTTCCGAGAATCCTTCCAATTGCTCGATTAAGTTTCTTTTTTTAAACCTGGCGGCCTCTTGGATGATGTTCCGCCTACTAACAAGGCCCCTTTATCTAACCTCCTTGACATCCTTCACCGCAGCCGATAATGATTCTCTATTTTCTCCCTGGCTTTCTGAATTTCTCTTATGATTTGTGCTGTACGCATCTTGTCGCACTCTACTTATGGTCATGCGTCCTTCTTTCCTGCATTAACTGGGCATTATAGCCAAGCTTTGCTCATCCATTAATCTCTACAAACAGGTCACTCATCATTCATATATAACATCATTATTTGTCATAACAAGTTTAAAACCGACCGAAAAATTACATCCCCCTAACTTACCTCCACAAAAATCAAAAAAACTTAACTTTAGAAGCAAAAGAACTGTCCAAAAAAATTTGACCGGGGATGAGAATTAAGAGANCGAAANNTGATATTTCATNCANGCATTGGCGTTGGGGTGGTGAGAAAGAAGANAACAATANATGGTAAAAAAAAATCGNTANNTNGAAAGAAAAAAGAAAAAAANNCGNNNNNTTGGNNNGNGGGAGGAAAAGAAATGGAAGNNNNGNGANGNNNNNNNNNNANNNNNNNNNNGANNNGNNNNNNNNCAAAAAAAAANGAGAGAAAAAAAAGAAAAAGAGAAANNNNNNNNNNNNNNNANNGGGNNNNNNNNNAAAAAAGAAAAAAAANAAAAAGAAAAAAAGGNNNGNNNNANNNNNNNNNNNGNNNNNNNNNNNNNGGGNNNNNGNNNNNNNNGNNGNNNNNNGNNNAAAAAANAAAGAAAAANNNAGANGNNNNNNANANNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNANNNGNNGNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNGNNNNNNNNNNNAAAANNNGNGNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNGGNNNNNNNNNNNNAAAAAGAGAAAAANAGAAGAGAAGAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAGAAAAAAAANAAAAAAAANNAGNNNGNNNNNGGNNNNNNNNNNNAANNNNNNNNGNNNNNNNNNNNNNNNNGGANNNNNNGNNGNNNNNNNNNN
Full Trace Sequence: GGCCAGGGTAACAGCCACTGAAGATGGTAAAACGAACCACTAAGAGGGGAGAACAGCCAGGAGGGCAAAAACGATGATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGCTACTTAAGTGGTTGACTTGACTGGCCCTTCTGTGAATTTCTTCCGAGAATCCTTCCAATTGCTCGATTAAGTTTCTTTTTTTAAACCTGGCGGCCTCTTGGATGATGTTCCGCCTACTAACAAGGCCCCTTTATCTAACCTCCTTGACATCCTTCACCGCAGCCGATAATGATTCTCTATTTTCTCCCTGGCTTTCTGAATTTCTCTTATGATTTGTGCTGTACGCATCTTGTCGCACTCTACTTATGGTCATGCGTCCTTCTTTCCTGCATTAACTGGGCATTATAGCCAAGCTTTGCTCATCCATTAATCTCTACAAACAGGTCACTCATCATTCATATATAACATCATTATTTGTCATAACAAGTTTAAAACCGACCGAAAAATTACATCCCCCTAACTTACCTCCACAAAAATCAAAAAAACTTAACTTTAGAAGCAAAAGAACTGTCCAAAAAAATTTGACCGGGGATGAGAATTAAGAGANCGAAANNTGATATTTCATNCANGCATTGGCGTTGGGGTGGTGAGAAAGAAGANAACAATANATGGTAAAAAAAAATCGNTANNTNGAAAGAAAAAAGAAAAAAANNCGNNNNNTTGGNNNGNGGGAGGAAAAGAAATGGAAGNNNNGNGANGNNNNNNNNNNANNNNNNNNNNGANNNGNNNNNNNNCAAAAAAAAANGAGAGAAAAAAAAGAAAAAGAGAAANNNNNNNNNNNNNNNANNGGGNNNNNNNNNAAAAAAGAAAAAAAANAAAAAGAAAAAAAGGNNNGNNNNANNNNNNNNNNNGNNNNNNNNNNNNNGGGNNNNNGNNNNNNNNGNNGNNNNNNGNNNAAAAAANAAAGAAAAANNNAGANGNNNNNNANANNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNANNNGNNGNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNGNNNNNNNNNNNAAAANNNGNGNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNGGNNNNNNNNNNNNAAAAAGAGAAAAANAGAAGAGAAGAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAGAAAAAAAANAAAAAAAANNAGNNNGNNNNNGGNNNNNNNNNNNAANNNNNNNNGNNNNNNNNNNNNNNNNGGANNNNNNGNNGNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGCTACTTAAGTGGTTGAC