ORFeome > irak1bp1 ORF1 – XORFeome v1.0

irak1bp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: irak1bp1
Gene ID: 960911
Gene Page ID: 960906
ORF Xenbase ID: 17280513

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124989
Original XGC clone length: 738

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ837553
dbEST ID: 79655255
Trimmed Sequence: ATGGCTGCCACTTCCCCCGTGTCCCGTATTTTTGCTTCTTTACAGCCAGCGAACTCCTCAGCCTTACACACGGGCGACTTGGAAAACAGAGCTGGCATAGTTGTTGGGCAACACGGAGGGCGGGAGGTGCAAGTTAGCGGTAGCGCGGAACTAAGCGCTGCTCCTGACAGGGCTCAAGTATGTATTGCGGTTAGCAGCAGTAAAGGTACAGCGGCTGAAGCCAAGAGCAGCGTGCAGAGGCGCCTGGAGTACATCGCACAGAGTCTACGGCAAGGGGGAGTGACGGAAGAAAATATAACAGTATCCAAGGAATTTCAAAGACTATCAAACACATACAAGATGGAAGCAGTGGTATGCGTTGTATTCAGTGACTTTGATAAACTGCAGAGCAACTGCAACTTGCTTGTTGAAAAACTAGACAGCTCAGTGAACATAAGCCCTCCACATTTCTATCATACAGCAGATTGCCTGGAAAAATTAAGGCGGGAAGTTTGTCTTGGTGCAGTTGCTAATGCCCGGCGAAAAGCTCAAGAGGTATGTCGTTTGGTTGGCCACTCACTAGGGAAAGCTTTAATCATCAGAGAAGAAGAATTGAGGGAATGGGAAAAATCAACAGAGAACTCTCAAGCACACCAATCTATTCAGTCCAAAATTAAAACTGCCCACAAATATGCCACCCTCACAAATTTAACAAACCTTTTAAATAAAAGGAAAAAAAAAAGGGCCAAGGGGAAAGCGTTTGGGCAAAGTTCCTGGGTAAAAAAATTGGGAATAAAAAGAAAAGGAATTGGGGAAGGGAAAAGTTGGTTG
Full Trace Sequence: GGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCACTTCCCCCGTGTCCCGTATTTTTGCTTCTTTACAGCCAGCGAACTCCTCAGCCTTACACACGGGCGACTTGGAAAACAGAGCTGGCATAGTTGTTGGGCAACACGGAGGGCGGGAGGTGCAAGTTAGCGGTAGCGCGGAACTAAGCGCTGCTCCTGACAGGGCTCAAGTATGTATTGCGGTTAGCAGCAGTAAAGGTACAGCGGCTGAAGCCAAGAGCAGCGTGCAGAGGCGCCTGGAGTACATCGCACAGAGTCTACGGCAAGGGGGAGTGACGGAAGAAAATATAACAGTATCCAAGGAATTTCAAAGACTATCAAACACATACAAGATGGAAGCAGTGGTATGCGTTGTATTCAGTGACTTTGATAAACTGCAGAGCAACTGCAACTTGCTTGTTGAAAAACTAGACAGCTCAGTGAACATAAGCCCTCCACATTTCTATCATACAGCAGATTGCCTGGAAAAATTAAGGCGGGAAGTTTGTCTTGGTGCAGTTGCTAATGCCCGGCGAAAAGCTCAAGAGGTATGTCGTTTGGTTGGCCACTCACTAGGGAAAGCTTTAATCATCAGAGAAGAAGAATTGAGGGAATGGGAAAAATCAACAGAGAACTCTCAAGCACACCAATCTATTCAGTCCAAAATTAAAACTGCCCACAAATATGCCACCCTCACAAATTTAACAAACCTTTTAAATAAAAGGAAAAAAAAAAGGGCCAAGGGGAAAGCGTTTGGGCAAAGTTCCTGGGTAAAAAAATTGGGAATAAAAAGAAAAGGAATTGGGGAAGGGAAAAGTTGGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCACTTCCCCCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837552
dbEST ID: 79655254
Trimmed Sequence: ACGGTTCTTTTTGTGCCTCTCTTTTCCCTTTATTTCAAAGGTTGCTAAAATCTTTGAGGCTGCATATATTGTGGCAGTCTTAATTTTAGACTGAATAGACTGGTGTGCTTGAGAGCTCTCTGCTTGATCTTCCCATTCCCTCAACTCTTCTTCTCTGATGATTAAAGCTTTCCCTAGTGAGTGGCCAACCAAACGACATACCTCTTGAGCTTTTCGCCGGGCATTAGCAACTGCACCAAGACAAACTTCCCGCCTTAATTTTTCCAGGCAATCTGCTGTATGATAGAAATGTGGAGGGCTTATGTTCACTGAGCTGTCTAGTTTTTCAACAAGCAAGTTGCAGTTGCTCTGCAGTTTATCAAAGTCACTGAATACAACACATACCACTGCTTCCATCTTGTATGTGTTTGATAGTCTTTGAAATTCCTTGGATACTGTTATATGTTCTTCCGTCACTCCCCCTTGCCGTAGACTCTATACAAAGTACTCCAGGCCCCGCTGGCCGCTGCTCTTGGCTTCGGCCGCTCTACCTTGACTACTGGCTAGCCGAATACATACTTGAGCCCTGTCAGGAGCAGCGCGTAGTTTCTCGCCGCCGCCGGCTTGCGGCCCCGGCCCCCCCACGCTTCCCCACGACTAAAACAAAACTCTTTTTTCTTAGTCGCCCCTTGTGTATGGGTGGGGAGATGGGGGTGGCGGATGAAAAAGGAAAGAAGAATAAAAAAAAAAGGGGGAAAGGGGGGAGGGCGAGGGGGGGGCCGGACCTTTTGTTTT
Full Trace Sequence: GGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGTTCTTTTTGTGCCTCTCTTTTCCCTTTATTTCAAAGGTTGCTAAAATCTTTGAGGCTGCATATATTGTGGCAGTCTTAATTTTAGACTGAATAGACTGGTGTGCTTGAGAGCTCTCTGCTTGATCTTCCCATTCCCTCAACTCTTCTTCTCTGATGATTAAAGCTTTCCCTAGTGAGTGGCCAACCAAACGACATACCTCTTGAGCTTTTCGCCGGGCATTAGCAACTGCACCAAGACAAACTTCCCGCCTTAATTTTTCCAGGCAATCTGCTGTATGATAGAAATGTGGAGGGCTTATGTTCACTGAGCTGTCTAGTTTTTCAACAAGCAAGTTGCAGTTGCTCTGCAGTTTATCAAAGTCACTGAATACAACACATACCACTGCTTCCATCTTGTATGTGTTTGATAGTCTTTGAAATTCCTTGGATACTGTTATATGTTCTTCCGTCACTCCCCCTTGCCGTAGACTCTATACAAAGTACTCCAGGCCCCGCTGGCCGCTGCTCTTGGCTTCGGCCGCTCTACCTTGACTACTGGCTAGCCGAATACATACTTGAGCCCTGTCAGGAGCAGCGCGTAGTTTCTCGCCGCCGCCGGCTTGCGGCCCCGGCCCCCCCACGCTTCCCCACGACTAAAACAAAACTCTTTTTTCTTAGTCGCCCCTTGTGTATGGGTGGGGAGATGGGGGTGGCGGATGAAAAAGGAAAGAAGAATAAAAAAAAAAGGGGGAAAGGGGGGAGGGCGAGGGGGGGGCCGGACCTTTTGTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGTTCTTTTTGTGCCTCT